miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-455-3p | ||||
| miRNA Stemloop AC | MI0003513 | ||||
| miRNA Stemloop ID | hsa-mir-455 | ||||
| Sequence | gcaguccaugggcauauacac | ||||
| TTD Target(s) Regulated by This miRNA | Histone deacetylase 2 (HDAC2) | Clinical trial Target | Target Info | [1] | |
| Mucin-1 (MUC1) | Clinical trial Target | Target Info | [2] | ||
| Histone deacetylase 8 (HDAC8) | Clinical trial Target | Target Info | [1] | ||
| Eukaryotic initiation factor 4E (EIF4E) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Alpha-(1,6)-fucosyltransferase | Regulated Protein | [4] | ||
| Etoposide-induced protein 2.4 homolog | Regulated Protein | [5] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | MicroRNA-455-3p modulates cartilage development and degeneration through modification of histone H3 acetylation. Biochim Biophys Acta. 2016 Dec;1863(12):2881-2891. | ||||
| REF 2 | Changes in microRNA and mRNA expression with differentiation of human bronchial epithelial cells. Am J Respir Cell Mol Biol. 2013 Sep;49(3):384-95. | ||||
| REF 3 | MicroRNA-455-3p functions as a tumor suppressor by targeting eIF4E in prostate cancer. Oncol Rep. 2017 Apr;37(4):2449-2458. | ||||
| REF 4 | Comprehensive N-glycan profiles of hepatocellular carcinoma reveal association of fucosylation with tumor progression and regulation of FUT8 by microRNAs.Oncotarget. 2016 Sep 20;7(38):61199-61214. | ||||
| REF 5 | MicroRNA-455-3p promotes invasion and migration in triple negative breast cancer by targeting tumor suppressor EI24.Oncotarget. 2017 Mar 21;8(12):19455-19466. | ||||
| REF 6 | MicroRNA-455 suppresses non-small cell lung cancer through targeting ZEB1.Cell Biol Int. 2016 Jun;40(6):621-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.