miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-483-3p | ||||
| miRNA Stemloop AC | MI0002467 | ||||
| miRNA Stemloop ID | hsa-mir-483 | ||||
| Sequence | ucacuccucuccucccgucuu | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [1] | |
| Connective tissue growth factor (CTGF) | Clinical trial Target | Target Info | [2] | ||
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [3] | ||
| Bcl-2-binding component 3 (BBC3) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Etoposide-induced protein 2.4 homolog | Regulated Protein | [5] | ||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [6] | |||
| Partitioning defective 3 homolog | Regulated Protein | [7] | |||
| Ras-specific guanine nucleotide-releasing factor 1 | Regulated Protein | [1] | |||
| Rho GTPase-activating protein 7 | Regulated Protein | [9] | |||
| Serum response factor | Regulated Protein | [10] | |||
| References | |||||
| REF 1 | CDC25A targeting by miR-483-3p decreases CCND-CDK4/6 assembly and contributes to cell cycle arrest. Cell Death Differ. 2013 Jun;20(6):800-11. | ||||
| REF 2 | miR-483 Targeting of CTGF Suppresses Endothelial-to-Mesenchymal Transition: Therapeutic Implications in Kawasaki Disease. Circ Res. 2017 Jan 20;120(2):354-365. | ||||
| REF 3 | IGF-1 promotes the development and cytotoxic activity of human NK cells. Nat Commun. 2013;4:1479. | ||||
| REF 4 | Oncogenic role of miR-483-3p at the IGF2/483 locus. Cancer Res. 2010 Apr 15;70(8):3140-9. | ||||
| REF 5 | miR-483-3p plays an oncogenic role in esophageal squamous cell carcinoma by targeting tumor suppressor EI24.Cell Biol Int. 2016 Apr;40(4):448-55. | ||||
| REF 6 | MicroRNA 483-3p suppresses the expression of DPC4/Smad4 in pancreatic cancer.FEBS Lett. 2011 Jan 3;585(1):207-13. | ||||
| REF 7 | Identification of specific miRNAs targeting proteins of the apical junctional complex that simulate the probiotic effect of E. coli Nissle 1917 on T84 epithelial cells.Int J Biochem Cell Biol. 2012 Feb;44(2):341-9. | ||||
| REF 8 | CDC25A targeting by miR-483-3p decreases CCND-CDK4/6 assembly and contributes to cell cycle arrest. Cell Death Differ. 2013 Jun;20(6):800-11. | ||||
| REF 9 | IGF2-derived miR-483 mediated oncofunction by suppressing DLC-1 and associated with colorectal cancer.Oncotarget. 2016 Jul 26;7(30):48456-48466. | ||||
| REF 10 | Upregulation of miR-483-3p contributes to endothelial progenitor cells dysfunction in deep vein thrombosis patients via SRF.J Transl Med. 2016 Jan 22;14:23. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.