miRNA General Information
miRNA Mature ID	hsa-miR-490-5p
miRNA Stemloop AC	MI0003125
miRNA Stemloop ID	hsa-mir-490
Sequence	ccauggaucuccaggugggu
TTD Target(s) Regulated by This miRNA	PI3-kinase alpha (PIK3CA)	Successful Target	Target Info	[1]
	Bone morphogenetic protein receptor (BMPR2)	Literature-reported Target	Target Info	[2]
	Proto-oncogene c-Fos (c-Fos)	Literature-reported Target	Target Info	[3]
References
REF 1	miR-490-5p suppresses tumour growth in renal cell carcinoma through targeting PIK3CA. Biol Cell. 2016 Feb;108(2):41-50.
REF 2	MicroRNA expression profiles in human adipose-derived stem cells during chondrogenic differentiation. Int J Mol Med. 2015 Mar;35(3):579-86.
REF 3	MicroRNA-490-5p inhibits proliferation of bladder cancer by targeting c-Fos. Biochem Biophys Res Commun. 2013 Nov 29;441(4):976-81.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.