miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-519b-3p | ||||
| miRNA Stemloop AC | MI0003151 | ||||
| miRNA Stemloop ID | hsa-mir-519b | ||||
| Sequence | aaagugcauccuuuuagagguu | ||||
| TTD Target(s) Regulated by This miRNA | ELAV-like protein 1 (ELAVL1) | Literature-reported Target | Target Info | [1] | |
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | miR-519 reduces cell proliferation by lowering RNA-binding protein HuR levels. Proc Natl Acad Sci U S A. 2008 Dec 23;105(51):20297-302. | ||||
| REF 2 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.