miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-519c-3p | ||||
| miRNA Stemloop AC | MI0003148 | ||||
| miRNA Stemloop ID | hsa-mir-519c | ||||
| Sequence | aaagugcaucuuuuuagaggau | ||||
| TTD Target(s) Regulated by This miRNA | ATP-binding cassette transporter G2 (ABCG2) | Successful Target | Target Info | [1] | |
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [2] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [3] | ||
| ELAV-like protein 1 (ELAVL1) | Literature-reported Target | Target Info | [4] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Metalloproteinase inhibitor 2 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MicroRNAs play a role in the development of human hematopoietic stem cells. J Cell Biochem. 2008 Jun 1;104(3):805-17. | ||||
| REF 2 | MicroRNA-519c suppresses hypoxia-inducible factor-1alpha expression and tumor angiogenesis. Cancer Res. 2010 Apr 1;70(7):2675-85. | ||||
| REF 3 | In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85. | ||||
| REF 4 | miR-519 reduces cell proliferation by lowering RNA-binding protein HuR levels. Proc Natl Acad Sci U S A. 2008 Dec 23;105(51):20297-302. | ||||
| REF 5 | In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.