miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-524-5p | ||||
| miRNA Stemloop AC | MI0003160 | ||||
| miRNA Stemloop ID | hsa-mir-524 | ||||
| Sequence | cuacaaagggaagcacuuucuc | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [1] | ||
| Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [2] | ||
| Wee1-like protein kinase (WEE1) | Clinical trial Target | Target Info | [2] | ||
| Dual specificity protein kinase TTK (MPS1) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Protein jagged-1 | Regulated Protein | [3] | ||
| Transcription factor HES-1 | Regulated Protein | [3] | |||
| Transcription factor SOX-9 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | MicroRNA-524-5p suppresses the growth and invasive abilities of gastric cancer cells. Oncol Lett. 2016 Mar;11(3):1926-1932. | ||||
| REF 2 | Comprehensive analysis of the functional microRNA-mRNA regulatory network identifies miRNA signatures associated with glioma malignant progression. Nucleic Acids Res. 2013 Dec;41(22):e203. | ||||
| REF 3 | The putative tumor suppressor miR-524-5p directly targets Jagged-1 and Hes-1 in glioma.Carcinogenesis. 2012 Nov;33(11):2276-82. | ||||
| REF 4 | Upregulation of microRNA-524-5p enhances the cisplatin sensitivity of gastric cancer cells by modulating proliferation and metastasis via targeting SOX9.Oncotarget. 2017 Jan 3;8(1):574-582. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.