miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-542-3p | ||||
| miRNA Stemloop AC | MI0003686 | ||||
| miRNA Stemloop ID | hsa-mir-542 | ||||
| Sequence | ugugacagauugauaacugaaa | ||||
| TTD Target(s) Regulated by This miRNA | RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [1] | |
| Angiopoietin-2 (ANGPT2) | Successful Target | Target Info | [2] | ||
| Apoptosis inhibitor survivin (BIRC5) | Clinical trial Target | Target Info | [3] | ||
| Serine/threonine-protein kinase pim-1 (PIM1) | Clinical trial Target | Target Info | [4] | ||
| Frizzled-7 receptor (FZD7) | Clinical trial Target | Target Info | [5] | ||
| Integrin-linked protein kinase 1 (ILK) | Patented-recorded Target | Target Info | [1] | ||
| Insulin-like growth factor-binding protein 1 (IGFBP1) | Literature-reported Target | Target Info | [6] | ||
| Metastasis adhesion protein (MTDH) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | 40S ribosomal protein S23 | Regulated Protein | [8] | ||
| Bone morphogenetic protein 7 | Regulated Protein | [9] | |||
| Phosphatidylinositol 3-kinase regulatory subunit alpha | Regulated Protein | [1] | |||
| Src substrate cortactin | Regulated Protein | [11] | |||
| Ubiquitin thioesterase OTUB1 | Regulated Protein | [12] | |||
| References | |||||
| REF 1 | MicroRNA-542-3p Suppresses Tumor Cell Invasion via Targeting AKT Pathway in Human Astrocytoma. J Biol Chem. 2015 Oct 9;290(41):24678-88. | ||||
| REF 2 | MicroRNA-542-3p inhibits tumour angiogenesis by targeting angiopoietin-2. J Pathol. 2014 Apr;232(5):499-508. | ||||
| REF 3 | Induction of growth arrest by miR-542-3p that targets survivin. FEBS Lett. 2010 Sep 24;584(18):4048-52. | ||||
| REF 4 | miR-542-3p suppresses invasion and metastasis by targeting the proto-oncogene serine/threonine protein kinase, PIM1, in melanoma. Biochem Biophys Res Commun. 2016 May 27;474(2):315-320. | ||||
| REF 5 | MicroRNA-542-3p inhibits the growth of hepatocellular carcinoma cells by targeting FZD7/Wnt signaling pathway. Biochem Biophys Res Commun. 2017 Jan 1;482(1):100-105. | ||||
| REF 6 | Loss of miR-542-3p enhances IGFBP-1 expression in decidualizing human endometrial stromal cells. Sci Rep. 2017 Jan 4;7:40001. | ||||
| REF 7 | MicroRNA-542-3p suppresses cell growth of gastric cancer cells via targeting oncogene astrocyte-elevated gene-1. Med Oncol. 2015 Jan;32(1):361. | ||||
| REF 8 | p53 is positively regulated by miR-542-3p.Cancer Res. 2014 Jun 15;74(12):3218-27. | ||||
| REF 9 | miR-542-3p suppresses osteoblast cell proliferation and differentiation, targets BMP-7 signaling and inhibits bone formation.Cell Death Dis. 2014 Feb 6;5:e1050. | ||||
| REF 10 | MicroRNA-542-3p Suppresses Tumor Cell Invasion via Targeting AKT Pathway in Human Astrocytoma. J Biol Chem. 2015 Oct 9;290(41):24678-88. | ||||
| REF 11 | miR-542-3p inhibits the growth and invasion of colorectal cancer cells through targeted regulation of cortactin.Int J Mol Med. 2016 Apr;37(4):1112-8. | ||||
| REF 12 | miR-542-3p inhibits colorectal cancer cell proliferation, migration and invasion by targeting OTUB1. Am J Cancer Res. 2017 Jan 1;7(1):159-172. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.