miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-542-5p | ||||
| miRNA Stemloop AC | MI0003686 | ||||
| miRNA Stemloop ID | hsa-mir-542 | ||||
| Sequence | ucggggaucaucaugucacgaga | ||||
| TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | E3 ubiquitin-protein ligase HUWE1 | Regulated Protein | [2] | ||
| Endophilin-B2 | Regulated Protein | [3] | |||
| Glutamate receptor ionotropic, NMDA 3A | Regulated Protein | [3] | |||
| SRC kinase signaling inhibitor 1 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Isolation of miRNAs that target EGFR mRNA in human lung cancer. Biochem Biophys Res Commun. 2012 Apr 6;420(2):411-6. | ||||
| REF 2 | MiR-542-5p is a negative prognostic factor and promotes osteosarcoma tumorigenesis by targeting HUWE1.Oncotarget. 2015 Dec 15;6(40):42761-72. | ||||
| REF 3 | MicroRNA-542-5p as a novel tumor suppressor in neuroblastoma.Cancer Lett. 2011 Apr 1;303(1):56-64. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.