miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-545-3p | ||||
| miRNA Stemloop AC | MI0003516 | ||||
| miRNA Stemloop ID | hsa-mir-545 | ||||
| Sequence | ucagcaaacauuuauugugugc | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [1] | |
| LDL receptor related protein-1 (LRP-1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Zinc finger protein SNAI2 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 2 | MicroRNA-205 inhibits tumor cell migration through down-regulating the expression of the LDL receptor-related protein 1. Biochem Biophys Res Commun. 2009 Oct 16;388(2):400-5. | ||||
| REF 3 | Angiopoietin-like protein 1 suppresses SLUG to inhibit cancer cell motility.J Clin Invest. 2013 Mar;123(3):1082-95. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.