miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-572 | ||||
| miRNA Stemloop AC | MI0003579 | ||||
| miRNA Stemloop ID | hsa-mir-572 | ||||
| Sequence | guccgcucggcgguggccca | ||||
| TTD Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Cytokine-inducible SH2-containing protein | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 2 | Upregulation of miR-572 transcriptionally suppresses SOCS1 and p21 and contributes to human ovarian cancer progression.Oncotarget. 2015 Jun 20;6(17):15180-93. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.