miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-610 | ||||
| miRNA Stemloop AC | MI0003623 | ||||
| miRNA Stemloop ID | hsa-mir-610 | ||||
| Sequence | ugagcuaaaugugugcuggga | ||||
| TTD Target(s) Regulated by This miRNA | Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [1] | |
| Hepatoma-derived growth factor (HDGF) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Vasodilator-stimulated phosphoprotein | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MicroRNA-610 is downregulated in glioma cells, and inhibits proliferation and motility by directly targeting MDM2. Mol Med Rep. 2016 Sep;14(3):2657-64. | ||||
| REF 2 | MiR-610 inhibits cell proliferation and invasion in colorectal cancer by repressing hepatoma-derived growth factor. Am J Cancer Res. 2015 Nov 15;5(12):3635-44. | ||||
| REF 3 | MicroRNA-610 inhibits the migration and invasion of gastric cancer cells by suppressing the expression of vasodilator-stimulated phosphoprotein.Eur J Cancer. 2012 Aug;48(12):1904-13. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.