miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-630 | ||||
| miRNA Stemloop AC | MI0003644 | ||||
| miRNA Stemloop ID | hsa-mir-630 | ||||
| Sequence | aguauucuguaccagggaaggu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-W (BCL-W) | Clinical trial Target | Target Info | [3] | ||
| Forkhead box protein M1 (FOXM1) | Literature-reported Target | Target Info | [4] | ||
| Metastasis adhesion protein (MTDH) | Literature-reported Target | Target Info | [5] | ||
| Yes-associated protein 1 (YAP1) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Dual specificity protein phosphatase CDC14A | Regulated Protein | [7] | ||
| EKC/KEOPS complex subunit TP53RK | Regulated Protein | [8] | |||
| Zinc finger protein SNAI2 | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | Upregulation of miR-150* and miR-630 induces apoptosis in pancreatic cancer cells by targeting IGF-1R. PLoS One. 2013 May 10;8(5):e61015. | ||||
| REF 2 | miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9. | ||||
| REF 3 | miR-122 targets an anti-apoptotic gene, Bcl-w, in human hepatocellular carcinoma cell lines. Biochem Biophys Res Commun. 2008 Oct 24;375(3):315-20. | ||||
| REF 4 | MicroRNA-630 Suppresses Epithelial-to-Mesenchymal Transition by Regulating FoxM1 in Gastric Cancer Cells. Biochemistry (Mosc). 2017 Jun;82(6):707-714. | ||||
| REF 5 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 6 | Phospho-Np63 is a key regulator of the cisplatin-induced microRNAome in cancer cells. Cell Death Differ. 2011 Jul;18(7):1220-30. | ||||
| REF 7 | Inhibition of miR-630 enhances the cell resistance to radiation by directly targeting CDC14A in human glioma. Am J Transl Res. 2017 Mar 15;9(3):1255-1265. | ||||
| REF 8 | Novel Epigenetic CREB-miR-630 Signaling Axis Regulates Radiosensitivity in Colorectal Cancer. PLoS One. 2015 Aug 11;10(8):e0133870. | ||||
| REF 9 | Angiopoietin-like protein 1 suppresses SLUG to inhibit cancer cell motility.J Clin Invest. 2013 Mar;123(3):1082-95. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.