miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-639 | ||||
| miRNA Stemloop AC | MI0003654 | ||||
| miRNA Stemloop ID | hsa-mir-639 | ||||
| Sequence | aucgcugcgguugcgagcgcugu | ||||
| TTD Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [1] | |
| Forkhead box protein C1 (FOXC1) | Literature-reported Target | Target Info | [2] | ||
| References | |||||
| REF 1 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 2 | miR-639 regulates transforming growth factor beta-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting FOXC1. Cancer Sci. 2014 Oct;105(10):1288-98. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.