miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-657 | ||||
| miRNA Stemloop AC | MI0003681 | ||||
| miRNA Stemloop ID | hsa-mir-657 | ||||
| Sequence | ggcagguucucacccucucuagg | ||||
| TTD Target(s) Regulated by This miRNA | CI Man-6-P receptor (IGF2R) | Clinical trial Target | Target Info | [1] | |
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Transducin-like enhancer protein 1 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Allele-specific targeting of hsa-miR-657 to human IGF2R creates a potential mechanism underlying the association of ACAA-insertion/deletion polymorphism with type 2 diabetes. Biochem Biophys Res Commun. 2008 Sep 12;374(1):101-5. | ||||
| REF 2 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 3 | MicroRNA-657 promotes tumorigenesis in hepatocellular carcinoma by targeting transducin-like enhancer protein 1 through nuclear factor kappa B pathways.Hepatology. 2013 May;57(5):1919-30. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.