miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-661 | ||||
| miRNA Stemloop AC | MI0003669 | ||||
| miRNA Stemloop ID | hsa-mir-661 | ||||
| Sequence | ugccugggucucuggccugcgcgu | ||||
| TTD Target(s) Regulated by This miRNA | O-6-methylguanine-DNA-alkyltransferase (MGMT) | Clinical trial Target | Target Info | [1] | |
| Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [2] | ||
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [3] | ||
| Metastasis associated gene-1 (MTA1) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Cytochrome c1, heme protein, mitochondrial | Regulated Protein | [5] | ||
| Metastasis-associated protein MTA2 | Regulated Protein | [4] | |||
| Nectin-1 | Regulated Protein | [7] | |||
| Protein Mdm4 | Regulated Protein | [2] | |||
| START domain-containing protein 10 | Regulated Protein | [7] | |||
| Vinculin | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | In human glioblastomas transcript elongation by alternative polyadenylation and miRNA targeting is a potent mechanism of MGMT silencing. Acta Neuropathol. 2013 May;125(5):671-81. | ||||
| REF 2 | miR-661 downregulates both Mdm2 and Mdm4 to activate p53. Cell Death Differ. 2014 Feb;21(2):302-9. | ||||
| REF 3 | A microRNA screen to identify modulators of sensitivity to BCL2 inhibitor ABT-263 (navitoclax). Mol Cancer Ther. 2010 Nov;9(11):2943-50. | ||||
| REF 4 | MicroRNA-661, a c/EBPalpha target, inhibits metastatic tumor antigen 1 and regulates its functions. Cancer Res. 2009 Jul 15;69(14):5639-42. | ||||
| REF 5 | MicroRNA-661 Enhances TRAIL or STS Induced Osteosarcoma Cell Apoptosis by Modulating the Expression of Cytochrome c1.Cell Physiol Biochem. 2017;41(5):1935-1946. | ||||
| REF 6 | MicroRNA-661, a c/EBPalpha target, inhibits metastatic tumor antigen 1 and regulates its functions. Cancer Res. 2009 Jul 15;69(14):5639-42. | ||||
| REF 7 | miR-661 expression in SNAI1-induced epithelial to mesenchymal transition contributes to breast cancer cell invasion by targeting Nectin-1 and StarD10 messengers.Oncogene. 2010 Aug 5;29(31):4436-48. | ||||
| REF 8 | miR-661 downregulates both Mdm2 and Mdm4 to activate p53. Cell Death Differ. 2014 Feb;21(2):302-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.