miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-675-5p | ||||
| miRNA Stemloop AC | MI0005416 | ||||
| miRNA Stemloop ID | hsa-mir-675 | ||||
| Sequence | uggugcggagagggcccacagug | ||||
| TTD Target(s) Regulated by This miRNA | Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [1] | |
| G-protein coupled receptor 55 (GPR55) | Successful Target | Target Info | [2] | ||
| Histone deacetylase 6 (HDAC6) | Clinical trial Target | Target Info | [3] | ||
| Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [3] | ||
| Histone deacetylase 5 (HDAC5) | Patented-recorded Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Calcium-binding protein 8 | Regulated Protein | [4] | ||
| Cell division control protein 6 homolog | Regulated Protein | [5] | |||
| DNA damage-binding protein 2 | Regulated Protein | [6] | |||
| Microphthalmia-associated transcription factor | Regulated Protein | [7] | |||
| Nodal modulator 1 | Regulated Protein | [8] | |||
| Phospholipid-transporting ATPase IB | Regulated Protein | [9] | |||
| RalBP1-associated Eps domain-containing protein 2 | Regulated Protein | [10] | |||
| Retinoblastoma-associated protein | Regulated Protein | [11] | |||
| Runt-related transcription factor 1 | Regulated Protein | [12] | |||
| Runt-related transcription factor 1 | Regulated Protein | [13] | |||
| Transforming growth factor-beta-induced protein ig-h3 | Regulated Protein | [14] | |||
| References | |||||
| REF 1 | Long Noncoding RNA H19 Promotes Osteoblast Differentiation Via TGF-1/Smad3/HDAC Signaling Pathway by Deriving miR-675. Stem Cells. 2015 Dec;33(12):3481-92. | ||||
| REF 2 | Down-regulation of miR-675-5p contributes to tumor progression and development by targeting pro-tumorigenic GPR55 in non-small cell lung cancer. Mol Cancer. 2015 Apr 1;14:73. | ||||
| REF 3 | Long Non-coding RNA H19 Inhibits Adipocyte Differentiation of Bone Marrow Mesenchymal Stem Cells through Epigenetic Modulation of Histone Deacetylases. Sci Rep. 2016 Jun 28;6:28897. | ||||
| REF 4 | Overexpression of lncRNA H19 enhances carcinogenesis and metastasis of gastric cancer.Oncotarget. 2014 Apr 30;5(8):2318-29. | ||||
| REF 5 | The H19 long noncoding RNA gives rise to microRNAs miR-675-3p and miR-675-5p to promote skeletal muscle differentiation and regeneration.Genes Dev. 2014 Mar 1;28(5):491-501. | ||||
| REF 6 | MiR-675-5p supports hypoxia induced epithelial to mesenchymal transition in colon cancer cells.Oncotarget. 2017 Apr 11;8(15):24292-24302. | ||||
| REF 7 | Reduced MiR-675 in exosome in H19 RNA-related melanogenesis via MITF as a direct target.J Invest Dermatol. 2014 Apr;134(4):1075-1082. | ||||
| REF 8 | The imprinted H19 gene regulates human placental trophoblast cell proliferation via encoding miR-675 that targets Nodal Modulator 1 (NOMO1).RNA Biol. 2012 Jul;9(7):1002-10. | ||||
| REF 9 | MiR-9-5p, miR-675-5p and miR-138-5p Damages the Strontium and LRP5-Mediated Skeletal Cell Proliferation, Differentiation, and Adhesion.Int J Mol Sci. 2016 Feb 15;17(2):236. | ||||
| REF 10 | miR-675-5p enhances tumorigenesis and metastasis of esophageal squamous cell carcinoma by targeting REPS2.Oncotarget. 2016 May 24;7(21):30730-47. | ||||
| REF 11 | Oncofetal H19-derived miR-675 regulates tumor suppressor RB in human colorectal cancer.Carcinogenesis. 2010 Mar;31(3):350-8. | ||||
| REF 12 | The long non-coding RNA H19-derived miR-675 modulates human gastric cancer cell proliferation by targeting tumor suppressor RUNX1.Biochem Biophys Res Commun. 2014 Jun 6;448(3):315-22. | ||||
| REF 13 | Long Noncoding RNA H19-Derived miR-675 Enhances Proliferation and Invasion via RUNX1 in Gastric Cancer Cells.Oncol Res. 2016;23(3):99-107. | ||||
| REF 14 | lncRNA H19/miR-675 axis represses prostate cancer metastasis by targeting TGFBI.FEBS J. 2014 Aug;281(16):3766-75. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.