miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-7-5p
miRNA Stemloop AC MI0000263 | MI0000264 | MI0000265
miRNA Stemloop ID hsa-mir-7-1 | hsa-mir-7-2 | hsa-mir-7-3
Sequence uggaagacuagugauuuuguugu
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
Proto-oncogene c-RAF (c-RAF) Clinical trial Target Target Info [2]
Synuclein alpha (SNCA) Clinical trial Target Target Info [3]
Activated CDC42 kinase 1 (ACK-1) Patented-recorded Target Target Info [4]
PAK-1 protein kinase (PAK1) Literature-reported Target Target Info [5]
Insulin receptor substrate-1 (IRS1) Clinical trial Target Target Info [6]
Protein(s) Regulated by This miRNA Apoptosis regulator BAX Regulated Protein
BAX_HUMAN
[7]
Cullin-5 Regulated Protein
CUL5_HUMAN
[8]
Cytochrome c oxidase subunit NDUFA4 Regulated Protein
NDUA4_HUMAN
[9]
DNA mismatch repair protein Msh3 Regulated Protein
MSH3_HUMAN
[10]
DNA repair protein XRCC2 Regulated Protein
XRCC2_HUMAN
[11]
E3 ubiquitin-protein ligase RNF183 Regulated Protein
RN183_HUMAN
[12]
Homeobox protein Hox-B3 Regulated Protein
HXB3_HUMAN
[13]
Homeobox protein Hox-B5 Regulated Protein
HXB5_HUMAN
[14]
Insulin receptor substrate 2 Regulated Protein
IRS2_HUMAN
[1]
Interleukin enhancer-binding factor 2 Regulated Protein
ILF2_HUMAN
[16]
Interleukin enhancer-binding factor 3 Regulated Protein
ILF3_HUMAN
[17]
Lymphoid-specific helicase Regulated Protein
HELLS_HUMAN
[18]
Methylcytosine dioxygenase TET2 Regulated Protein
TET2_HUMAN
[19]
Paired box protein Pax-6 Regulated Protein
PAX6_HUMAN
[20]
Phosphatidylinositol 3-kinase regulatory subunit gamma Regulated Protein
P55G_HUMAN
[21]
Proteasome activator complex subunit 3 Regulated Protein
PSME3_HUMAN
[22]
Protein Jumonji Regulated Protein
JARD2_HUMAN
[23]
Regulator of G-protein signaling 5 Regulated Protein
RGS5_HUMAN
[24]
Serine/arginine-rich splicing factor 1 Regulated Protein
SRSF1_HUMAN
[25]
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1 Regulated Protein
SMRD1_HUMAN
[26]
Transcriptional repressor protein YY1 Regulated Protein
TYY1_HUMAN
[27]
Ubiquitin-conjugating enzyme E2 A Regulated Protein
UBE2A_HUMAN
[28]
Voltage-dependent anion-selective channel protein 1 Regulated Protein
VDAC1_HUMAN
[29]
Zinc finger protein Gfi-1 Regulated Protein
GFI1_HUMAN
[23]
References
REF 1 microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. Cancer Res. 2008 May 15;68(10):3566-72.
REF 2 Prevalence of anthelmintic resistance on sheep and goat farms in the southeastern United States. J Am Vet Med Assoc. 2008 Dec 15;233(12):1913-9.
REF 3 Repression of alpha-synuclein expression and toxicity by microRNA-7. Proc Natl Acad Sci U S A. 2009 Aug 4;106(31):13052-7.
REF 4 miRNA-7 attenuation in Schwannoma tumors stimulates growth by upregulating three oncogenic signaling pathways. Cancer Res. 2011 Feb 1;71(3):852-61.
REF 5 MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35.
REF 6 Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90.
REF 7 MicroRNA-7 inhibits neuronal apoptosis in a cellular Parkinson's disease model by targeting Bax and Sirt2. Am J Transl Res. 2016 Feb 15;8(2):993-1004.
REF 8 Downregulation of miR-7 upregulates Cullin 5 (CUL5) to facilitate G1/S transition in human hepatocellular carcinoma cells.IUBMB Life. 2013 Dec;65(12):1026-34.
REF 9 Targeted Expression of miR-7 Operated by TTF-1 Promoter Inhibited the Growth of Human Lung Cancer through the NDUFA4 Pathway.Mol Ther Nucleic Acids. 2017 Mar 17;6:183-197.
REF 10 miR-7 modulates chemoresistance of small cell lung cancer by repressing MRP1/ABCC1.Int J Exp Pathol. 2015 Aug;96(4):240-7.
REF 11 miR-7 inhibits colorectal cancer cell proliferation and induces apoptosis by targeting XRCC2.Onco Targets Ther. 2014 Feb 20;7:325-32.
REF 12 E3 Ubiquitin ligase RNF183 Is a Novel Regulator in Inflammatory Bowel Disease.J Crohns Colitis. 2016 Jun;10(6):713-25.
REF 13 miR-7 and miR-218 epigenetically control tumor suppressor genes RASSF1A and Claudin-6 by targeting HoxB3 in breast cancer.Biochem Biophys Res Commun. 2012 Jul 20;424(1):28-33.
REF 14 A microRNA-7 binding site polymorphism in HOXB5 leads to differential gene expression in bladder cancer.PLoS One. 2012;7(6):e40127.
REF 15 microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. Cancer Res. 2008 May 15;68(10):3566-72.
REF 16 MicroRNA-7 functions as a tumor-suppressor gene by regulating ILF2 in pancreatic carcinoma.Int J Mol Med. 2017 Apr;39(4):900-906.
REF 17 Suppression of MicroRNA-7 (miR-7) Biogenesis by Nuclear Factor 90-Nuclear Factor 45 Complex (NF90-NF45) Controls Cell Proliferation in Hepatocellul... J Biol Chem. 2016 Sep 30;291(40):21074-21084.
REF 18 Altered microRNA expression patterns in irradiated hematopoietic tissues suggest a sex-specific protective mechanism.Biochem Biophys Res Commun. 2008 Dec 5;377(1):41-5.
REF 19 An extensive network of TET2-targeting MicroRNAs regulates malignant hematopoiesis.Cell Rep. 2013 Oct 31;5(2):471-81.
REF 20 PAX6, a novel target of microRNA-7, promotes cellular proliferation and invasion in human colorectal cancer cells.Dig Dis Sci. 2014 Mar;59(3):598-606.
REF 21 MicroRNA-7-regulated TLR9 signaling-enhanced growth and metastatic potential of human lung cancer cells by altering the phosphoinositide-3-kinase, regulatory subunit 3/Akt pathway.Mol Biol Cell. 2013 Jan;24(1):42-55.
REF 22 MiR-7 triggers cell cycle arrest at the G1/S transition by targeting multiple genes including Skp2 and Psme3.PLoS One. 2013 Jun 6;8(6):e65671.
REF 23 Trichostatin A suppresses EGFR expression through induction of microRNA-7 in an HDAC-independent manner in lapatinib-treated cells.Biomed Res Int. 2014;2014:168949.
REF 24 MicroRNAs that target RGS5.Iran J Basic Med Sci. 2015 Feb;18(2):108-14.
REF 25 A splicing-independent function of SF2/ASF in microRNA processing.Mol Cell. 2010 Apr 9;38(1):67-77.
REF 26 MicroRNA-7 Compromises p53 Protein-dependent Apoptosis by Controlling the Expression of the Chromatin Remodeling Factor SMARCD1.J Biol Chem. 2016 Jan 22;291(4):1877-89.
REF 27 microRNA-7 is a novel inhibitor of YY1 contributing to colorectal tumorigenesis.Oncogene. 2013 Oct 17;32(42):5078-88.
REF 28 Deficiency in the Ubiquitin Conjugating Enzyme UBE2A in Alzheimer's Disease (AD) is Linked to Deficits in a Natural Circular miRNA-7 Sponge (circRNA; ciRS-7).Genes (Basel). 2016 Dec 5;7(12). pii: E116.
REF 29 MicroRNA-7 Regulates the Function of Mitochondrial Permeability Transition Pore by Targeting VDAC1 Expression.J Biol Chem. 2016 Mar 18;291(12):6483-93.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.