miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-874-3p | ||||
| miRNA Stemloop AC | MI0005532 | ||||
| miRNA Stemloop ID | hsa-mir-874 | ||||
| Sequence | cugcccuggcccgagggaccga | ||||
| TTD Target(s) Regulated by This miRNA | Histone deacetylase 1 (HDAC1) | Successful Target | Target Info | [1] | |
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [2] | ||
| Cyclin-dependent kinase 9 (CDK9) | Clinical trial Target | Target Info | [3] | ||
| Rotamase Pin1 (PIN1) | Clinical trial Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Aquaporin-3 | Regulated Protein | [5] | ||
| Aquaporin-3 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Tumour-suppressive microRNA-874 contributes to cell proliferation through targeting of histone deacetylase 1 in head and neck squamous cell carcinoma. Br J Cancer. 2013 Apr 30;108(8):1648-58. | ||||
| REF 2 | miR-874 functions as a tumor suppressor by inhibiting angiogenesis through STAT3/VEGF-A pathway in gastric cancer. Oncotarget. 2015 Jan 30;6(3):1605-17. | ||||
| REF 3 | MicroRNA-874 inhibits cell proliferation and induces apoptosis in human breast cancer by targeting CDK9. FEBS Lett. 2014 Dec 20;588(24):4527-35. | ||||
| REF 4 | miR-874-3p is down-regulated in hepatocellular carcinoma and negatively regulates PIN1 expression. Oncotarget. 2017 Feb 14;8(7):11343-11355. | ||||
| REF 5 | miR-874 Inhibits cell proliferation, migration and invasion through targeting aquaporin-3 in gastric cancer.J Gastroenterol. 2014 Jun;49(6):1011-25. | ||||
| REF 6 | MiR-874 promotes intestinal barrier dysfunction through targeting AQP3 following intestinal ischemic injury.FEBS Lett. 2014 Mar 3;588(5):757-63. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.