miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-885-5p | ||||
| miRNA Stemloop AC | MI0005560 | ||||
| miRNA Stemloop ID | hsa-mir-885 | ||||
| Sequence | uccauuacacuacccugccucu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Beta-catenin (CTNNB1) | Successful Target | Target Info | [2] | ||
| Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [3] | ||
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | DNA replication licensing factor MCM5 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | p73 and IGF1R Regulate Emergence of Aggressive Cancer Stem-like Features via miR-885-5p Control. Cancer Res. 2016 Jan 15;76(2):197-205. | ||||
| REF 2 | miR-885-5p suppresses hepatocellular carcinoma metastasis and inhibits Wnt/-catenin signaling pathway. Oncotarget. 2016 Nov 15;7(46):75038-75051. | ||||
| REF 3 | MicroRNA miR-885-5p targets CDK2 and MCM5, activates p53 and inhibits proliferation and survival. Cell Death Differ. 2011 Jun;18(6):974-84. | ||||
| REF 4 | A functional variant at the miR-885-5p binding site of CASP3 confers risk of both index and second primary malignancies in patients with head and neck cancer. FASEB J. 2013 Apr;27(4):1404-12. | ||||
| REF 5 | MicroRNA miR-885-5p targets CDK2 and MCM5, activates p53 and inhibits proliferation and survival. Cell Death Differ. 2011 Jun;18(6):974-84. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.