miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-887-3p | ||||
| miRNA Stemloop AC | MI0005562 | ||||
| miRNA Stemloop ID | hsa-mir-887 | ||||
| Sequence | gugaacgggcgccaucccgagg | ||||
| TTD Target(s) Regulated by This miRNA | Interleukin-1 beta (IL1B) | Successful Target | Target Info | [1] | |
| Phospholipase D2 (PLD2) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Protein Mdm4 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MiR-100-3p and miR-877-3p regulate overproduction of IL-8 and IL-1 in mesangial cells activated by secretory IgA from IgA nephropathy patients. Exp Cell Res. 2016 Oct 1;347(2):312-21. | ||||
| REF 2 | A Repertoire of MicroRNAs Regulates Cancer Cell Starvation by Targeting Phospholipase D in a Feedback Loop That Operates Maximally in Cancer Cells. Mol Cell Biol. 2016 Jan 19;36(7):1078-89. | ||||
| REF 3 | A genetic variant of MDM4 influences regulation by multiple microRNAs in prostate cancer.Endocr Relat Cancer. 2015 Apr;22(2):265-76. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.