miRNA General Information
miRNA Mature ID	hsa-miR-9-5p
miRNA Stemloop AC	MI0000466 | MI0000467 | MI0000468
miRNA Stemloop ID	hsa-mir-9-1 | hsa-mir-9-2 | hsa-mir-9-3
Sequence	ucuuugguuaucuagcuguauga
TTD Target(s) Regulated by This miRNA	NT-3 growth factor receptor (TrkC)	Successful Target	Target Info	[1]
	Beta-secretase 1 (BACE1)	Clinical trial Target	Target Info	[2]
	DNA-binding factor KBF1 (p105)	Clinical trial Target	Target Info	[3]
	Forkhead box protein O1A (FOXO1)	Literature-reported Target	Target Info	[4]
	Epithelial cadherin (CDH1)	Literature-reported Target	Target Info	[5]
Protein(s) Regulated by This miRNA	5'-3' exoribonuclease 2	Regulated Protein	XRN2_HUMAN	[6]
	5'-AMP-activated protein kinase catalytic subunit alpha-1	Regulated Protein	AAPK1_HUMAN	[7]
	AP-3 complex subunit beta-1	Regulated Protein	AP3B1_HUMAN	[8]
	Autophagy protein 5	Regulated Protein	ATG5_HUMAN	[9]
	B-cell lymphoma 6 protein	Regulated Protein	BCL6_HUMAN	[10]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[11]
	C-1-tetrahydrofolate synthase, cytoplasmic	Regulated Protein	C1TC_HUMAN	[12]
	Charged multivesicular body protein 2b	Regulated Protein	CHM2B_HUMAN	[13]
	Cullin-4A	Regulated Protein	CUL4A_HUMAN	[14]
	Cyclin-G1	Regulated Protein	CCNG1_HUMAN	[8]
	Cytochrome P450 4Z1	Regulated Protein	CP4Z1_HUMAN	[15]
	Cytoplasmic FMR1-interacting protein 2	Regulated Protein	CYFP2_HUMAN	[16]
	Cytoplasmic polyadenylation element-binding protein 4	Regulated Protein	CPEB4_HUMAN	[16]
	Double-stranded RNA-binding protein Staufen homolog 1	Regulated Protein	STAU1_HUMAN	[6]
	E3 ubiquitin-protein ligase UHRF1	Regulated Protein	UHRF1_HUMAN	[17]
	Endonuclease domain-containing 1 protein	Regulated Protein	ENDD1_HUMAN	[16]
	Endoribonuclease ZC3H12A	Regulated Protein	ZC12A_HUMAN	[18]
	Forkhead box protein O3	Regulated Protein	FOXO3_HUMAN	[19]
	Forkhead box protein P1	Regulated Protein	FOXP1_HUMAN	[20]
	HMG box-containing protein 1	Regulated Protein	HBP1_HUMAN	[16]
	Homeobox protein CDX-2	Regulated Protein	CDX2_HUMAN	[21]
	Insulin-like growth factor 2 mRNA-binding protein 1	Regulated Protein	IF2B1_HUMAN	[22]
	Insulin-like growth factor 2 mRNA-binding protein 3	Regulated Protein	IF2B3_HUMAN	[23]
	Krueppel-like factor 17	Regulated Protein	KLF17_HUMAN	[24]
	Krueppel-like factor 6	Regulated Protein	KLF6_HUMAN	[16]
	LHFPL tetraspan subfamily member 2 protein	Regulated Protein	LHPL2_HUMAN	[16]
	Myocardin	Regulated Protein	MYCD_HUMAN	[25]
	Neurofibromin	Regulated Protein	NF1_HUMAN	[26]
	Nuclear receptor subfamily 2 group E member 1	Regulated Protein	NR2E1_HUMAN	[27]
	One cut domain family member 2	Regulated Protein	ONEC2_HUMAN	[28]
	Pituitary homeobox 3	Regulated Protein	PITX3_HUMAN	[29]
	Polypeptide N-acetylgalactosaminyltransferase 4	Regulated Protein	GALT4_HUMAN	[30]
	POU domain, class 2, transcription factor 2	Regulated Protein	PO2F2_HUMAN	[10]
	PR domain zinc finger protein 1	Regulated Protein	PRDM1_HUMAN	[31]
	Ras-related protein Rab-34	Regulated Protein	RAB34_HUMAN	[32]
	Ras-related protein Rab-34	Regulated Protein	RAB34_HUMAN	[33]
	Ras-related protein Rab-8B	Regulated Protein	RAB8B_HUMAN	[16]
	Ras-related protein Rap-2a	Regulated Protein	RAP2A_HUMAN	[34]
	RE1-silencing transcription factor	Regulated Protein	REST_HUMAN	[35]
	Rho-related GTP-binding protein RhoH	Regulated Protein	RHOH_HUMAN	[16]
	RING1 and YY1-binding protein	Regulated Protein	RYBP_HUMAN	[16]
	Runt-related transcription factor 1	Regulated Protein	RUNX1_HUMAN	[36]
	Serine/arginine-rich splicing factor 1	Regulated Protein	SRSF1_HUMAN	[6]
	Serpin B9	Regulated Protein	SPB9_HUMAN	[16]
	Serum response factor	Regulated Protein	SRF_HUMAN	[37]
	StAR-related lipid transfer protein 13	Regulated Protein	STA13_HUMAN	[38]
	Suppressor of cytokine signaling 5	Regulated Protein	SOCS5_HUMAN	[39]
	T-cell acute lymphocytic leukemia protein 1	Regulated Protein	TAL1_HUMAN	[16]
	Trafficking kinesin-binding protein 2	Regulated Protein	TRAK2_HUMAN	[16]
	Transcription factor HES-1	Regulated Protein	HES1_HUMAN	[40]
	Transcription factor SOX-7	Regulated Protein	SOX7_HUMAN	[41]
	Transforming growth factor-beta-induced protein ig-h3	Regulated Protein	BGH3_HUMAN	[42]
	Transmembrane 4 L6 family member 1	Regulated Protein	T4S1_HUMAN	[43]
	Tumor necrosis factor alpha-induced protein 8	Regulated Protein	TFIP8_HUMAN	[44]
	Vesicle-associated membrane protein 5	Regulated Protein	VAMP5_HUMAN	[16]
	Vimentin	Regulated Protein	VIME_HUMAN	[5]
References
REF 1	The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62.
REF 2	The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci. 2008 Jan 30;28(5):1213-23.
REF 3	MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene. 2007 Jun 14;26(28):4148-57.
REF 4	Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16.
REF 5	miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol. 2010 Mar;12(3):247-56.
REF 6	Transcriptome dynamics of the microRNA inhibition response.Nucleic Acids Res. 2015 Jul 27;43(13):6207-21.
REF 7	Neuroprotective Effect of Osthole on Neuron Synapses in an Alzheimer's Disease Cell Model via Upregulation of MicroRNA-9.J Mol Neurosci. 2016 Sep;60(1):71-81.
REF 8	MicroRNA-9 inhibition of cell proliferation and identification of novel miR-9 targets by transcriptome profiling in breast cancer cells.J Biol Chem. 2012 Aug 24;287(35):29516-28.
REF 9	Noncoding RNA blockade of autophagy is therapeutic in medullary thyroid cancer.Cancer Med. 2015 Feb;4(2):174-82.
REF 10	Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 11	MicroRNA-9 regulates neural apoptosis in methylmalonic acidemia via targeting BCL2L11.Int J Dev Neurosci. 2014 Aug;36:19-24.
REF 12	An NTD-associated polymorphism in the 3' UTR of MTHFD1L can affect disease risk by altering miRNA binding.Hum Mutat. 2014 Jan;35(1):96-104.
REF 13	MicroRNA-9 coordinates proliferation and migration of human embryonic stem cell-derived neural progenitors.Cell Stem Cell. 2010 Apr 2;6(4):323-35.
REF 14	Cullin 4A (CUL4A), a direct target of miR-9 and miR-137, promotes gastric cancer proliferation and invasion by regulating the Hippo signaling pathway.Oncotarget. 2016 Mar 1;7(9):10037-50.
REF 15	CYP4Z1 3'UTR represses migration of human breast cancer cells.Biochem Biophys Res Commun. 2016 Sep 16;478(2):900-7.
REF 16	miR-9 is an essential oncogenic microRNA specifically overexpressed in mixed lineage leukemia-rearranged leukemia.Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11511-6.
REF 17	Regulation of UHRF1 by microRNA-9 modulates colorectal cancer cell proliferation and apoptosis.Cancer Sci. 2015 Jul;106(7):833-9.
REF 18	MicroRNA-9 promotion of interleukin-6 expression by inhibiting monocyte chemoattractant protein-induced protein 1 expression in interleukin-1-stimulated human chondrocytes.Arthritis Rheumatol. 2015 May;67(8):2117-28.
REF 19	Critical role of miR-9 in myelopoiesis and EVI1-induced leukemogenesis.Proc Natl Acad Sci U S A. 2013 Apr 2;110(14):5594-9.
REF 20	Suppression of microRNA-9 by mutant EGFR signaling upregulates FOXP1 to enhance glioblastoma tumorigenicity.Cancer Res. 2014 Mar 1;74(5):1429-39.
REF 21	MiR-9 downregulates CDX2 expression in gastric cancer cells.Int J Cancer. 2011 Dec 1;129(11):2611-20.
REF 22	Comprehensive profiling of novel microRNA-9 targets and a tumor suppressor role of microRNA-9 via targeting IGF2BP1 in hepatocellular carcinoma.Oncotarget. 2015 Dec 8;6(39):42040-52.
REF 23	HDAC inhibitor AR-42 decreases CD44 expression and sensitizes myeloma cells to lenalidomide.Oncotarget. 2015 Oct 13;6(31):31134-50.
REF 24	MicroRNA-9 enhances migration and invasion through KLF17 in hepatocellular carcinoma.Mol Oncol. 2013 Oct;7(5):884-94.
REF 25	Aberrant Expression of microRNA-9 Contributes to Development of Intracranial Aneurysm by Suppressing Proliferation and Reducing Contractility of Smooth Muscle Cells.Med Sci Monit. 2016 Nov 8;22:4247-4253.
REF 26	The CREB-miR-9 negative feedback minicircuitry coordinates the migration and proliferation of glioma cells.PLoS One. 2012;7(11):e49570.
REF 27	A feedback regulatory loop involving microRNA-9 and nuclear receptor TLX in neural stem cell fate determination.Nat Struct Mol Biol. 2009 Apr;16(4):365-71.
REF 28	MicroRNA-9 controls the expression of Granuphilin/Slp4 and the secretory response of insulin-producing cells.J Biol Chem. 2006 Sep 15;281(37):26932-42.
REF 29	Pseudomonas aeruginosa GroEL Stimulates Production of PTX3 by Activating the NF-B Pathway and Simultaneously Downregulating MicroRNA-9.Infect Immun. 2017 Feb 23;85(3). pii: e00935-16.
REF 30	Loss of N-Acetylgalactosaminyltransferase-4 Orchestrates Oncogenic MicroRNA-9 in Hepatocellular Carcinoma.J Biol Chem. 2017 Feb 24;292(8):3186-3200.
REF 31	MicroRNA-mediated down-regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg cells: a potential pathogenetic lesion in Hodgkin lymphomas.Am J Pathol. 2008 Jul;173(1):242-52.
REF 32	Down-regulated miR-9 and miR-433 in human gastric carcinoma.J Exp Clin Cancer Res. 2009 Jun 16;28:82.
REF 33	MicroRNA profile of paclitaxel-resistant serous ovarian carcinoma based on formalin-fixed paraffin-embedded samples.BMC Cancer. 2013 Apr 30;13:216.
REF 34	miR-9 and miR-124 synergistically affect regulation of dendritic branching via the AKT/GSK3 pathway by targeting Rap2a.Sci Rep. 2016 May 25;6:26781.
REF 35	The bifunctional microRNA miR-9/miR-9* regulates REST and CoREST and is downregulated in Huntington's disease.J Neurosci. 2008 Dec 31;28(53):14341-6.
REF 36	MicroRNA-9 Regulates the Differentiation and Function of Myeloid-Derived Suppressor Cells via Targeting Runx1.J Immunol. 2015 Aug 1;195(3):1301-11.
REF 37	Regulation of serum response factor by miRNA-200 and miRNA-9 modulates oligodendrocyte progenitor cell differentiation.Glia. 2012 Dec;60(12):1906-14.
REF 38	miR-9 and miR-200 Regulate PDGFR-Mediated Endothelial Differentiation of Tumor Cells in Triple-Negative Breast Cancer.Cancer Res. 2016 Sep 15;76(18):5562-72.
REF 39	Tumour-secreted miR-9 promotes endothelial cell migration and angiogenesis by activating the JAK-STAT pathway.EMBO J. 2012 Aug 29;31(17):3513-23.
REF 40	Reciprocal Regulation between Bifunctional miR-9/9( and its Transcriptional Modulator Notch in Human Neural Stem Cell Self-Renewal and Differentiation.Stem Cell Reports. 2016 Aug 9;7(2):207-19.
REF 41	MiR-9 is involved in TGF-1-induced lung cancer cell invasion and adhesion by targeting SOX7.J Cell Mol Med. 2017 Sep;21(9):2000-2008.
REF 42	Target gene repression mediated by miRNAs miR-181c and miR-9 both of which are down-regulated by amyloid-. J Mol Neurosci. 2012 Feb;46(2):324-35.
REF 43	MicroRNA-9 suppresses cell migration and invasion through downregulation of TM4SF1 in colorectal cancer.Int J Oncol. 2016 May;48(5):2135-43.
REF 44	MicroRNA-9 inhibits the gastric cancer cell proliferation by targeting TNFAIP8. Cell Prolif. 2017 Apr;50(2).
REF 45	miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol. 2010 Mar;12(3):247-56.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.