miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-98-5p
miRNA Stemloop AC MI0000100
miRNA Stemloop ID hsa-mir-98
Sequence ugagguaguaaguuguauuguu
TTD Target(s) Regulated by This miRNA Aromatase (CYP19A1) Successful Target Target Info [1]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [2]
Interleukin-6 (IL6) Successful Target Target Info [3]
Thrombopoietin receptor (MPL) Successful Target Target Info [4]
Caspase-3 (CASP3) Clinical trial Target Target Info [5]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [6]
Interleukin-13 (IL13) Successful Target Target Info [7]
Monocyte chemotactic and activating factor (CCL2) Clinical trial Target Target Info [8]
GTPase NRas (NRAS) Clinical trial Target Target Info [3]
Interleukin-10 (IL10) Clinical trial Target Target Info [9]
T-cell-specific protein RANTES (CCL5) Clinical trial Target Target Info [8]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [10]
Thrombospondin-1 (THBS1) Clinical trial Target Target Info [11]
Tumor suppressor candidate 2 (TUSC2) Clinical trial Target Target Info [11]
Insulin-like growth factor-I (IGF1) Clinical trial Target Target Info [12]
Nuclear receptor coactivator 3 (NCOA3) Literature-reported Target Target Info [3]
Inhibitor of nuclear factor kappa-B kinase alpha (IKKA) Literature-reported Target Target Info [13]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [3]
PAK-1 protein kinase (PAK1) Literature-reported Target Target Info [14]
Signal transduction protein CBL (CBL) Literature-reported Target Target Info [15]
Endothelin-1 (EDN1) Literature-reported Target Target Info [16]
Integrin beta-3 (ITGB3) Literature-reported Target Target Info [17]
Opioid receptor sigma 2 (PGRMC1) Literature-reported Target Target Info [3]
Transcription factor E2F2 (E2F2) Literature-reported Target Target Info [10]
High mobility group protein HMGI-C (HMGA2) Literature-reported Target Target Info [18]
Protein(s) Regulated by This miRNA Acetylcholine receptor subunit beta Regulated Protein
ACHB_HUMAN
[11]
AMME syndrome candidate gene 1 protein Regulated Protein
AMMR1_HUMAN
[11]
CAAX prenyl protease 1 homolog Regulated Protein
FACE1_HUMAN
[11]
Catenin delta-1 Regulated Protein
CTND1_HUMAN
[20]
CCR4-NOT transcription complex subunit 4 Regulated Protein
CNOT4_HUMAN
[11]
Chromobox protein homolog 5 Regulated Protein
CBX5_HUMAN
[11]
Cyclin-J Regulated Protein
CCNJ_HUMAN
[21]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[22]
Heterogeneous nuclear ribonucleoprotein D-like Regulated Protein
HNRDL_HUMAN
[11]
Hexokinase-2 Regulated Protein
HXK2_HUMAN
[23]
High affinity copper uptake protein 1 Regulated Protein
COPT1_HUMAN
[24]
Homeobox protein Meis1 Regulated Protein
MEIS1_HUMAN
[11]
Krueppel-like factor 13 Regulated Protein
KLF13_HUMAN
[25]
Medium-chain specific acyl-CoA dehydrogenase, mitochondrial Regulated Protein
ACADM_HUMAN
[11]
mRNA decay activator protein ZFP36L1 Regulated Protein
TISB_HUMAN
[11]
Pre-B-cell leukemia transcription factor 3 Regulated Protein
PBX3_HUMAN
[26]
Sal-like protein 4 Regulated Protein
SALL4_HUMAN
[27]
Sodium-dependent phosphate transporter 1 Regulated Protein
S20A1_HUMAN
[11]
Sorting nexin-6 Regulated Protein
SNX6_HUMAN
[28]
Stress-associated endoplasmic reticulum protein 1 Regulated Protein
SERP1_HUMAN
[11]
Suppressor of cytokine signaling 4 Regulated Protein
SOCS4_HUMAN
[29]
Transcription factor E2F5 Regulated Protein
E2F5_HUMAN
[30]
References
REF 1 Evidence for microRNA-mediated regulation of steroidogenesis by hypoxia. Environ Sci Technol. 2015 Jan 20;49(2):1138-47.
REF 2 Upregulation of microRNA-98 increases radiosensitivity in esophageal squamous cell carcinoma. J Radiat Res. 2016 Sep;57(5):468-476.
REF 3 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
REF 4 miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45.
REF 5 miR-98 protects endothelial cells against hypoxia/reoxygenation induced-apoptosis by targeting caspase-3. Biochem Biophys Res Commun. 2015 Nov 20;467(3):595-601.
REF 6 Mir-214-dependent regulation of the polycomb protein Ezh2 in skeletal muscle and embryonic stem cells. Mol Cell. 2009 Oct 9;36(1):61-74.
REF 7 Let-7 microRNA-mediated regulation of IL-13 and allergic airway inflammation. J Allergy Clin Immunol. 2011 Nov;128(5):1077-85.e1-10.
REF 8 miR-98 and let-7g* protect the blood-brain barrier under neuroinflammatory conditions. J Cereb Blood Flow Metab. 2015 Dec;35(12):1957-65.
REF 9 Micro RNA-98 interferes with expression interleukin-10 in peripheral B cells of patients with lung cancer. Sci Rep. 2016 Sep 8;6:32754.
REF 10 Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009 Aug;37(14):4850-61.
REF 11 MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70.
REF 12 miR-98 suppresses tumor cell growth and metastasis by targeting IGF1R in oral squamous cell carcinoma. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12252-9.
REF 13 MicroRNA mediation of endothelial inflammatory response to smooth muscle cells and its inhibition by atheroprotective shear stress. Circ Res. 2015 Mar 27;116(7):1157-69.
REF 14 MiR-98 inhibits cell proliferation and invasion of non-small cell carcinoma lung cancer by targeting PAK1. Int J Clin Exp Med. 2015 Nov 15;8(11):20135-45.
REF 15 Overexpression of X-linked genes in T cells from women with lupus. J Autoimmun. 2013 Mar;41:60-71.
REF 16 Peroxisome Proliferator-Activated Receptor and microRNA 98 in Hypoxia-Induced Endothelin-1 Signaling. Am J Respir Cell Mol Biol. 2016 Jan;54(1):136-46.
REF 17 miR-98 targets ITGB3 to inhibit proliferation, migration, and invasion of non-small-cell lung cancer. Onco Targets Ther. 2015 Sep 22;8:2689-97.
REF 18 High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5.
REF 19 MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007 Oct 15;67(20):9762-70.
REF 20 miR-98 and its host gene Huwe1 target Caspase-3 in Silica nanoparticles-treated male germ cells.Sci Rep. 2015 Aug 11;5:12938.
REF 21 Identification of microRNA-98 as a therapeutic target inhibiting prostate cancer growth and a biomarker induced by vitamin D.J Biol Chem. 2013 Jan 4;288(1):1-9.
REF 22 High glucose concentration induces endothelial cell proliferation by regulating cyclin-D2-related miR-98.J Cell Mol Med. 2016 Jun;20(6):1159-69.
REF 23 MicroRNA-98 Suppress Warburg Effect by Targeting HK2 in Colon Cancer Cells.Dig Dis Sci. 2017 Mar;62(3):660-668.
REF 24 NEAT1 upregulates EGCG-induced CTR1 to enhance cisplatin sensitivity in lung cancer cells.Oncotarget. 2016 Jul 12;7(28):43337-43351.
REF 25 MicroRNA-125a contributes to elevated inflammatory chemokine RANTES levels via targeting KLF13 in systemic lupus erythematosus. Arthritis Rheum. 2010 Nov;62(11):3425-35.
REF 26 MicroRNA-98 Attenuates Cell Migration and Invasion in Glioma by Directly Targeting Pre-B Cell Leukemia Homeobox 3.Cell Mol Neurobiol. 2017 Nov;37(8):1359-1371.
REF 27 MicroRNA-98 acts as a tumor suppressor in hepatocellular carcinoma via targeting SALL4.Oncotarget. 2016 Nov 8;7(45):74059-74073.
REF 28 miR-98-5p Acts as a Target for Alzheimer's Disease by Regulating A Production Through Modulating SNX6 Expression. J Mol Neurosci. 2016 Dec;60(4):413-420.
REF 29 MicroRNA-98 and let-7 regulate expression of suppressor of cytokine signaling 4 in biliary epithelial cells in response to Cryptosporidium parvum infection.J Infect Dis. 2010 Jul 1;202(1):125-35.
REF 30 miR-98 delays skeletal muscle differentiation by down-regulating E2F5.Biochem J. 2015 Feb 15;466(1):85-93.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.