miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-99a-5p | ||||
| miRNA Stemloop AC | MI0000101 | ||||
| miRNA Stemloop ID | hsa-mir-99a | ||||
| Sequence | aacccguagauccgaucuugug | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | ||
| Fibroblast growth factor receptor 3 (FGFR3) | Successful Target | Target Info | [2] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [3] | ||
| Endothelial plasminogen activator inhibitor (SERPINE1) | Clinical trial Target | Target Info | [4] | ||
| NADPH oxidase 4 (NOX4) | Clinical trial Target | Target Info | [5] | ||
| FK506-binding protein 5 (FKBP5) | Literature-reported Target | Target Info | [6] | ||
| Protein(s) Regulated by This miRNA | Calpain small subunit 1 | Regulated Protein | [7] | ||
| CTD small phosphatase-like protein | Regulated Protein | [8] | |||
| Grainyhead-like protein 1 homolog | Regulated Protein | [9] | |||
| Homeobox protein Hox-A1 | Regulated Protein | [10] | |||
| Myotubularin-related protein 3 | Regulated Protein | [11] | |||
| Protein argonaute-2 | Regulated Protein | [12] | |||
| Ribonucleoprotein PTB-binding 2 | Regulated Protein | [13] | |||
| Serine/threonine-protein phosphatase PP1-beta catalytic subunit | Regulated Protein | [9] | |||
| SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 | Regulated Protein | [14] | |||
| Tribbles homolog 2 | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | Regulation of insulin-like growth factor-mammalian target of rapamycin signaling by microRNA in childhood adrenocortical tumors. Cancer Res. 2010 Jun 1;70(11):4666-75. | ||||
| REF 2 | Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. Genes Chromosomes Cancer. 2009 Jul;48(7):569-82. | ||||
| REF 3 | miR-99a suppresses the metastasis of human non-small cell lung cancer cells by targeting AKT1 signaling pathway. J Cell Biochem. 2015 Feb;116(2):268-76. | ||||
| REF 4 | Involvement of miR-30c and miR-301a in immediate induction of plasminogen activator inhibitor-1 by placental growth factor in human pulmonary endothelial cells. Biochem J. 2011 Mar 15;434(3):473-82. | ||||
| REF 5 | MiR-99a regulates ROS-mediated invasion and migration of lung adenocarcinoma cells by targeting NOX4. Oncol Rep. 2016 May;35(5):2755-66. | ||||
| REF 6 | MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer. 2013 Oct 15;109(8):2189-98. | ||||
| REF 7 | MiR-99a and MiR-491 Regulate Cisplatin Resistance in Human Gastric Cancer Cells by Targeting CAPNS1. Int J Biol Sci. 2016 Nov 5;12(12):1437-1447. | ||||
| REF 8 | MiR-99a may serve as a potential oncogene in pediatric myeloid leukemia.Cancer Cell Int. 2013 Nov 5;13(1):110. | ||||
| REF 9 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
| REF 10 | MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells. PLoS One. 2013 Dec 3;8(12):e80625. | ||||
| REF 11 | MiR-99a exerts anti-metastasis through inhibiting myotubularin-related protein 3 expression in oral cancer.Oral Dis. 2014 Apr;20(3):e65-75. | ||||
| REF 12 | MiRNA-99a directly regulates AGO2 through translational repression in hepatocellular carcinoma.Oncogenesis. 2014 Apr 14;3:e97. | ||||
| REF 13 | Identification of human microRNA targets from isolated argonaute protein complexes.RNA Biol. 2007 Jun;4(2):76-84. | ||||
| REF 14 | The miR-99 family regulates the DNA damage response through its target SNF2H.Oncogene. 2013 Feb 28;32(9):1164-72. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.