Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T07217 |
Target Info
|
| Target Name |
Fatty acid-binding protein 4 (FABP4) |
| Synonyms |
Fatty acid-binding protein, adipocyte; Adipocyte-type fatty acid-binding protein; Adipocyte lipid-binding protein; Adipocyte fatty-acid-binding protein; Adipocyte fatty binding protein; ALBP; AFABP; A-FABP |
| Target Type |
Patented-recorded Target |
| Gene Name |
FABP4 |
| Biochemical Class |
Fatty acid binding protein |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-369-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agaucgaccguguuauauucgc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Luciferase activity decreased upon co-transfection with miR-369-5p implying that miR-369-5p binds directly to the 3'UTR of FABP4 to decrease gene expression and thereby inhibiting adipogenesis. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
DNA [cytosine-5]-methyltransferase 3A (DNMT3A)
|
Target Info
|
|
|
DNA [cytosine-5]-methyltransferase 3B (DNMT3B)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Adipogenic differentiation of human mesenchymal stromal cells is down-regulated by microRNA-369-5p and up-regulated by microRNA-371. J Cell Physiol. 2011 Sep;226(9):2226-34.
|
| REF 2 |
Adenovirus-mediated interference of FABP4 regulates mRNA expression of ADIPOQ, LEP and LEPR in bovine adipocytes. Genet Mol Res. 2013 Feb 27;12(1):494-505.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
