Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T09538 |
Target Info
|
| Target Name |
Alkaline phosphatase tissue-nonspecific (ALPL) |
| Synonyms |
TNSALP; Liver/bone/kidney isozyme; Alkaline phosphatase, tissue-nonspecific isozyme; Alkaline phosphatase liver/bone/kidney isozyme; AP-TNAP |
| Target Type |
Successful Target |
| Gene Name |
ALPL |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuaugccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Alkaline Phosphatase (ALP) is a Direct Target of mir-204. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Identification and characterization of microRNAs controlled by the osteoblast-specific transcription factor Osterix. PLoS One. 2013;8(3):e58104.
|
| REF 2 |
Effects of endogenous hypercortisolism on bone mRNA and microRNA expression in humans. Osteoporos Int. 2018 Jan;29(1):211-221.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
