Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T10877 |
Target Info
|
| Target Name |
Cyclic ADP-ribose hydrolase 1 (CD38) |
| Synonyms |
cADPr hydrolase 1; T10; Cyclic ADPribose hydrolase 1; ADPribosyl cyclase 1; ADPRC 1; ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1; ADP-ribosyl cyclase 1; 2'-phospho-cyclic-ADP-ribose transferase; 2'-phospho-ADP-ribosyl cyclase/2'-phospho-cyclic-ADP-ribose transferase; 2'-phospho-ADP-ribosyl cyclase |
| Target Type |
Successful Target |
| Gene Name |
CD38 |
| Biochemical Class |
Glycosylase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-140-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaccacaggguagaaccacgg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-140-3p targets on the CD38 3'UTR. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Cyclic ADP-ribose hydrolase 1 (CD38)
|
Target Info
|
|
|
Fibronectin (FN1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-140-3p regulation of TNF--induced CD38 expression in human airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol. 2012 Sep;303(5):L460-8.
|
| REF 2 |
CD38/cADPR Signaling Pathway in Airway Disease: Regulatory Mechanisms. Mediators Inflamm. 2018 Feb 7;2018:8942042.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
