Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T13259 Target Info
Target Name Succinate-semialdehyde dehydrogenase (ALDH5A1)
Synonyms Succinic dehydrogenase; Succinate-semialdehyde dehydrogenase, mitochondrial; SSADH; NAD(+)-dependent succinic semialdehyde dehydrogenase; Aldehyde dehydrogenase family 5 member A1
Target Type Successful Target
Gene Name ALDH5A1
Biochemical Class Aldehyde/oxo donor oxidoreductase
UniProt ID
P51649
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism ALDH5A is identified initially as miR-210 targets. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Expression of ALDH5A1 was suppressed by transfection with hsa-miR-29a-3p mimics. [2]
Evidence Score (E-score) 1 +
1 EMSA; Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 Seed-Milarity confers to hsa-miR-210 and hsa-miR-147b similar functional activity. PLoS One. 2012;7(9):e44919.
REF 2 Modulation of ALDH5A1 and SLC22A7 by microRNA hsa-miR-29a-3p in human liver cells. Biochem Pharmacol. 2015 Dec 15;98(4):671-80.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.