miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-210-3p
miRNA Stemloop AC MI0000286
miRNA Stemloop ID hsa-mir-210
Sequence cugugcgugugacagcggcuga
TTD Target(s) Regulated by This miRNA Tyrosine-protein kinase BTK (ATK) Successful Target Target Info [1]
Succinate-semialdehyde dehydrogenase (ALDH5A1) Successful Target Target Info [2]
Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1) Clinical trial Target Target Info [3]
Polo-like kinase 1 (PLK1) Clinical trial Target Target Info [4]
Protein-tyrosine phosphatase 1B (PTP1B) Clinical trial Target Target Info [5]
Serine/threonine-protein kinase pim-1 (PIM1) Clinical trial Target Target Info [6]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [5]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [7]
Lactate dehydrogenase A (LDHA) Literature-reported Target Target Info [8]
Activin receptor type IB (ACVR1B) Patented-recorded Target Target Info [5]
Transferrin receptor protein 1 (TFRC) Clinical trial Target Target Info [9]
Autophagy-related protein 7 (ATG7) Literature-reported Target Target Info [10]
DNA repair protein complementing XP-A cells (XPA) Literature-reported Target Target Info [11]
ETS domain-containing protein Elk-3 (ELK3) Literature-reported Target Target Info [5]
Insulin-like growth factor-binding protein 3 (IGFBP3) Clinical trial Target Target Info [2]
Stathmin-1 (STMN1) Literature-reported Target Target Info [12]
Protein(s) Regulated by This miRNA Adenomatous polyposis coli protein Regulated Protein
APC_HUMAN
[5]
Apoptosis-inducing factor 3 Regulated Protein
AIFM3_HUMAN
[14]
ATP-binding cassette sub-family B member 9 Regulated Protein
ABCB9_HUMAN
[5]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 Regulated Protein
BNIP3_HUMAN
[15]
CASP8-associated protein 2 Regulated Protein
C8AP2_HUMAN
[16]
Chromobox protein homolog 1 Regulated Protein
CBX1_HUMAN
[5]
Chromodomain-helicase-DNA-binding protein 9 Regulated Protein
CHD9_HUMAN
[5]
CLIP-associating protein 2 Regulated Protein
CLAP2_HUMAN
[5]
Collagen alpha-2(IV) chain Regulated Protein
CO4A2_HUMAN
[2]
Cyclin-dependent kinase 10 Regulated Protein
CDK10_HUMAN
[5]
Cytochrome c oxidase subunit NDUFA4 Regulated Protein
NDUA4_HUMAN
[18]
Cytoplasmic polyadenylation element-binding protein 2 Regulated Protein
CPEB2_HUMAN
[5]
DNA repair protein RAD52 homolog Regulated Protein
RAD52_HUMAN
[11]
DNA replication licensing factor MCM3 Regulated Protein
MCM3_HUMAN
[2]
Double-strand break repair protein MRE11 Regulated Protein
MRE11_HUMAN
[11]
E3 ubiquitin-protein ligase HECTD1 Regulated Protein
HECD1_HUMAN
[5]
E3 ubiquitin-protein ligase KCMF1 Regulated Protein
KCMF1_HUMAN
[20]
E3 ubiquitin-protein ligase MIB1 Regulated Protein
MIB1_HUMAN
[5]
EH domain-containing protein 2 Regulated Protein
EHD2_HUMAN
[2]
Ephrin-A3 Regulated Protein
EFNA3_HUMAN
[21]
Fibroblast growth factor receptor-like 1 Regulated Protein
FGRL1_HUMAN
[22]
Fibroblast growth factor receptor-like 1 Regulated Protein
FGRL1_HUMAN
[23]
Forkhead box protein N3 Regulated Protein
FOXN3_HUMAN
[2]
Forkhead box protein P3 Regulated Protein
FOXP3_HUMAN
[24]
Glycerol-3-phosphate dehydrogenase 1-like protein Regulated Protein
GPD1L_HUMAN
[5]
Homeobox protein Hox-A1 Regulated Protein
HXA1_HUMAN
[6]
Homeobox protein Hox-A3 Regulated Protein
HXA3_HUMAN
[5]
Homeobox protein Hox-A9 Regulated Protein
HXA9_HUMAN
[6]
Hypoxia-inducible factor 3-alpha Regulated Protein
HIF3A_HUMAN
[26]
Iron-sulfur cluster assembly enzyme ISCU, mitochondrial Regulated Protein
ISCU_HUMAN
[5]
L-lactate dehydrogenase B chain Regulated Protein
LDHB_HUMAN
[8]
MAM domain-containing glycosylphosphatidylinositol anchor protein 1 Regulated Protein
MDGA1_HUMAN
[5]
Max-binding protein MNT Regulated Protein
MNT_HUMAN
[28]
Mid1-interacting protein 1 Regulated Protein
M1IP1_HUMAN
[5]
Myogenesis-regulating glycosidase Regulated Protein
MYORG_HUMAN
[5]
N(G),N(G)-dimethylarginine dimethylaminohydrolase 1 Regulated Protein
DDAH1_HUMAN
[5]
Neural cell adhesion molecule 1 Regulated Protein
NCAM1_HUMAN
[5]
Neuronal pentraxin-1 Regulated Protein
NPTX1_HUMAN
[29]
Nipped-B-like protein Regulated Protein
NIPBL_HUMAN
[5]
Nucleoporin SEH1 Regulated Protein
SEH1_HUMAN
[5]
Phospholipid-transporting ATPase IG Regulated Protein
AT11C_HUMAN
[5]
Polypyrimidine tract-binding protein 3 Regulated Protein
PTBP3_HUMAN
[30]
Probable dimethyladenosine transferase Regulated Protein
DIM1_HUMAN
[12]
Protein DENND6A Regulated Protein
DEN6A_HUMAN
[5]
Protein prenyltransferase alpha subunit repeat-containing protein 1 Regulated Protein
PTAR1_HUMAN
[5]
SERTA domain-containing protein 2 Regulated Protein
SRTD2_HUMAN
[5]
SH3 domain-binding glutamic acid-rich-like protein Regulated Protein
SH3L1_HUMAN
[2]
Structural maintenance of chromosomes flexible hinge domain-containing protein 1 Regulated Protein
SMHD1_HUMAN
[5]
Succinate dehydrogenase [ubiquinone] cytochrome b small subunit, mitochondrial Regulated Protein
DHSD_HUMAN
[18]
Thrombospondin type-1 domain-containing protein 7A Regulated Protein
THS7A_HUMAN
[32]
Transportin-1 Regulated Protein
TNPO1_HUMAN
[5]
Tumor protein p53-inducible protein 11 Regulated Protein
P5I11_HUMAN
[6]
Twist-related protein 1 Regulated Protein
TWST1_HUMAN
[33]
Type I inositol 1,4,5-trisphosphate 5-phosphatase Regulated Protein
I5P1_HUMAN
[2]
Tyrosine-protein phosphatase non-receptor type 2 Regulated Protein
PTN2_HUMAN
[34]
Ubiquilin-1 Regulated Protein
UBQL1_HUMAN
[5]
Vacuole membrane protein 1 Regulated Protein
VMP1_HUMAN
[35]
References
REF 1 Targeting BTK through microRNA in chronic lymphocytic leukemia. Blood. 2016 Dec 29;128(26):3101-3112.
REF 2 Seed-Milarity confers to hsa-miR-210 and hsa-miR-147b similar functional activity. PLoS One. 2012;7(9):e44919.
REF 3 Hydroxysteroid (17-) dehydrogenase 1 is dysregulated by miR-210 and miR-518c that are aberrantly expressed in preeclamptic placentas: a novel marker for predicting preeclampsia. Hypertension. 2012 Feb;59(2):265-73.
REF 4 Long noncoding RNA lnc-RI is a new regulator of mitosis via targeting miRNA-210-3p to release PLK1 mRNA activity. Sci Rep. 2016 May 10;6:25385.
REF 5 An integrated approach for experimental target identification of hypoxia-induced miR-210. J Biol Chem. 2009 Dec 11;284(50):35134-43.
REF 6 Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation. Mol Cell. 2009 Sep 24;35(6):856-67.
REF 7 Effects of knockdown of miR-210 in combination with ionizing radiation on human hepatoma xenograft in nude mice. Radiat Oncol. 2013 Apr 25;8:102.
REF 8 Estrogen and retinoic acid antagonistically regulate several microRNA genes to control aerobic glycolysis in breast cancer cells. Mol Biosyst. 2012 Oct 30;8(12):3242-53.
REF 9 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 10 Suppression of autophagy by extracellular vesicles promotes myofibroblast differentiation in COPD pathogenesis. J Extracell Vesicles. 2015 Nov 11;4:28388.
REF 11 MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 2009 Feb 1;69(3):1221-9.
REF 12 Epigenetic silencing of miR-210 increases the proliferation of gastric epithelium during chronic Helicobacter pylori infection. Nat Commun. 2014 Sep 4;5:4497.
REF 13 An integrated approach for experimental target identification of hypoxia-induced miR-210. J Biol Chem. 2009 Dec 11;284(50):35134-43.
REF 14 Downregulation of miR-210 expression inhibits proliferation, induces apoptosis and enhances radiosensitivity in hypoxic human hepatoma cells in vitro.Exp Cell Res. 2012 May 1;318(8):944-54.
REF 15 miR-210 suppresses BNIP3 to protect against the apoptosis of neural progenitor cells.Stem Cell Res. 2013 Jul;11(1):657-67.
REF 16 Ischemic preconditioning augments survival of stem cells via miR-210 expression by targeting caspase-8-associated protein 2.J Biol Chem. 2009 Nov 27;284(48):33161-8.
REF 17 Seed-Milarity confers to hsa-miR-210 and hsa-miR-147b similar functional activity. PLoS One. 2012;7(9):e44919.
REF 18 MiR-210 promotes a hypoxic phenotype and increases radioresistance in human lung cancer cell lines.Cell Death Dis. 2013 Mar 14;4:e544.
REF 19 MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 2009 Feb 1;69(3):1221-9.
REF 20 MicroRNA-210 contributes to preeclampsia by downregulating potassium channel modulatory factor 1.Hypertension. 2014 Oct;64(4):839-45.
REF 21 MicroRNA-210 modulates endothelial cell response to hypoxia and inhibits the receptor tyrosine kinase ligand Ephrin-A3.J Biol Chem. 2008 Jun 6;283(23):15878-83.
REF 22 MicroRNA-210 regulates cancer cell proliferation through targeting fibroblast growth factor receptor-like 1 (FGFRL1).J Biol Chem. 2011 Jan 7;286(1):420-8.
REF 23 MiR-210 links hypoxia with cell proliferation regulation in human Laryngocarcinoma cancer.J Cell Biochem. 2015 Jun;116(6):1039-49.
REF 24 Up-regulation of microRNA-210 induces immune dysfunction via targeting FOXP3 in CD4(+) T cells of psoriasis vulgaris.Clin Immunol. 2014 Jan;150(1):22-30.
REF 25 Hypoxia-inducible mir-210 regulates normoxic gene expression involved in tumor initiation. Mol Cell. 2009 Sep 24;35(6):856-67.
REF 26 MicroRNA response to hypoxic stress in soft tissue sarcoma cells: microRNA mediated regulation of HIF3.BMC Cancer. 2014 Jun 13;14:429.
REF 27 Estrogen and retinoic acid antagonistically regulate several microRNA genes to control aerobic glycolysis in breast cancer cells. Mol Biosyst. 2012 Oct 30;8(12):3242-53.
REF 28 MicroRNA miR-210 modulates cellular response to hypoxia through the MYC antagonist MNT. Cell Cycle. 2009 Sep 1;8(17):2756-68.
REF 29 Hypoxia induces microRNA miR-210 in vitro and in vivo ephrin-A3 and neuronal pentraxin 1 are potentially regulated by miR-210.FEBS Lett. 2008 Jul 9;582(16):2397-401.
REF 30 ROD1 is a seedless target gene of hypoxia-induced miR-210.PLoS One. 2012;7(9):e44651.
REF 31 Epigenetic silencing of miR-210 increases the proliferation of gastric epithelium during chronic Helicobacter pylori infection. Nat Commun. 2014 Sep 4;5:4497.
REF 32 Hypoxia-inducible miR-210 contributes to preeclampsia via targeting thrombospondin type I domain containing 7A.Sci Rep. 2016 Jan 22;6:19588.
REF 33 microRNA-210-3p depletion by CRISPR/Cas9 promoted tumorigenesis through revival of TWIST1 in renal cell carcinoma.Oncotarget. 2017 Mar 28;8(13):20881-20894.
REF 34 Reactive oxygen species-responsive miR-210 regulates proliferation and migration of adipose-derived stem cells via PTPN2.Cell Death Dis. 2013 Apr 11;4:e588.
REF 35 Hypoxia-inducible microRNA-210 augments the metastatic potential of tumor cells by targeting vacuole membrane protein 1 in hepatocellular carcinoma.Hepatology. 2011 Dec;54(6):2064-75.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.