The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
guccaguuuucccaggaaucccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
APRIL was regulated by miR-145 in gastric cancer cells. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-383-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agaucagaaggugauuguggcu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-383 directly targets TNFSF13 in HCC cells by interaction with its 3'UTR binding site, thereby reg- ulating endogenous TNFSF13 expression at both transcriptional and translational levels. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
G1/S-specific cyclin-D1 (CCND1)
|
Target Info
|
|