Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T14676 Target Info
Target Name A proliferation-inducing ligand (APRIL)
Synonyms ZTNF2; UNQ383/PRO715; Tumor necrosis factor ligand superfamily member 13; TRDL-1; TNF-related death ligand 1; TNF- and APOL-related leukocyte expressed ligand 2; TALL2; TALL-2; CD256
Target Type Clinical trial Target
Gene Name TNFSF13
Biochemical Class Cytokine: tumor necrosis factor
UniProt ID
O75888
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism APRIL was regulated by miR-145 in gastric cancer cells. [1]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-383-5p miRNA Info
miRNA Mature AC
MIMAT0000738
Sequence agaucagaaggugauuguggcu
miRNA Species Homo sapiens
Regulation Mechanism miR-383 directly targets TNFSF13 in HCC cells by interaction with its 3'UTR binding site, thereby reg- ulating endogenous TNFSF13 expression at both transcriptional and translational levels. [3]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
References  Top
REF 1 APRIL induces cisplatin resistance in gastric cancer cells via activation of the NF-B pathway. Cell Physiol Biochem. 2015;35(2):571-85.
REF 2 Upregulation of microRNA-383 inhibits the proliferation, migration and invasion of colon cancer cells. Oncol Lett. 2018 Jan;15(1):1184-1190.
REF 3 miR-383 inhibits hepatocellular carcinoma cell proliferation via targeting APRIL. Tumour Biol. 2016 Feb;37(2):2497-507.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.