Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T17814 | Target Info | |||
| Target Name | Opioid receptor sigma 2 (PGRMC1) | ||||
| Synonyms | mPR; PGRMC; Membraneassociated progesterone receptor component 1; Membrane-associated progesterone receptor component 1; IZA; HPR6.6; Dap1 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | PGRMC1 | ||||
| Biochemical Class | GPCR rhodopsin | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-98-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagguaguaaguuguauuguu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay; qRT-PCR; Western Blot | [1] | |||
| 2 | Microarray | [2] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Aromatase (CYP19A1) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Endometrial miR-181a and miR-98 expression is altered during transition from normal into cancerous state and target PGR, PGRMC1, CYP19A1, DDX3X, and TIMP3. J Clin Endocrinol Metab. 2012 Jul;97(7):E1316-26. | ||||
| REF 2 | MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.