Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T17980 Target Info
Target Name Fyn tyrosine protein kinase (FYN)
Synonyms Tyrosine-protein kinase Fyn; Src-like kinase; SLK; Proto-oncogene tyrosine-protein kinase Fyn; Proto-oncogene c-Fyn; Proto-oncogene Syn; Fyn p59-Fyn; Fyn Protooncogene Syn
Target Type Successful Target
Gene Name FYN
Biochemical Class Kinase
UniProt ID
P06241
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-3p miRNA Info
miRNA Mature AC
MIMAT0004602
Sequence acaggugagguucuugggagcc
miRNA Species Homo sapiens
Regulation Mechanism miR-125a-3p binds 3'UTR of FYN that leads to the reduced luciferase signal expressed by the psiCHECK-Fyn plasmid, suggesting that FYN is targeted by miR-125a-3p. [2]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
Fyn tyrosine protein kinase (FYN) Target Info
FYN_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism FYN was a direct target gene of miR-106b. [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
References  Top
REF 1 Aberrant expression of miR-125a-3p promotes fibroblast activation via Fyn/STAT3 pathway during silica-induced pulmonary fibrosis. Toxicology. 2019 Feb 15;414:57-67.
REF 2 microRNA-125a-3p reduces cell proliferation and migration by targeting Fyn. J Cell Sci. 2013 Jul 1;126(Pt 13):2867-76.
REF 3 miR-106b inhibits tau phosphorylation at Tyr18 by targeting Fyn in a model of Alzheimer's disease. Biochem Biophys Res Commun. 2016 Sep 16;478(2):852-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.