miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-106b-5p
miRNA Stemloop AC MI0000734
miRNA Stemloop ID hsa-mir-106b
Sequence uaaagugcugacagugcagau
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Fyn tyrosine protein kinase (FYN) Successful Target Target Info [2]
Amyloid beta A4 protein (APP) Successful Target Target Info [3]
Janus kinase 1 (JAK-1) Successful Target Target Info [4]
Osteoclast differentiation factor (ODF) Successful Target Target Info [5]
Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [6]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [4]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [7]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [8]
TRAIL receptor 1 (TRAIL-R1) Clinical trial Target Target Info [9]
Apoptosis mediating surface antigen FAS (FAS) Clinical trial Target Target Info [8]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [10]
Caspase-7 (CASP7) Clinical trial Target Target Info [4]
Glucose transporter type 4 (SLC2A4) Clinical trial Target Target Info [11]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [12]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [13]
Caspase-8 (CASP8) Patented-recorded Target Target Info [14]
Stress-activated protein kinase JNK2 (JNK2) Preclinical Target Target Info [7]
Histone acetyltransferase KAT2B (KAT2B) Literature-reported Target Target Info [4]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [15]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [8]
E3 ubiquitin protein ligase Itchy (ITCH) Literature-reported Target Target Info [16]
Lysine N-methyltransferase 3A (SETD2) Literature-reported Target Target Info [17]
NADPH oxidase 2 (CYBB) Literature-reported Target Target Info [18]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [19]
Runt-related transcription factor 3 (RUNX3) Literature-reported Target Target Info [20]
Protein(s) Regulated by This miRNA Adenomatous polyposis coli protein Regulated Protein
APC_HUMAN
[21]
Autophagy-related protein 16-1 Regulated Protein
A16L1_HUMAN
[22]
Bcl-2-like protein 11 Regulated Protein
B2L11_HUMAN
[23]
Disabled homolog 2 Regulated Protein
DAB2_HUMAN
[24]
E3 ubiquitin-protein ligase TRIM8 Regulated Protein
TRIM8_HUMAN
[25]
Eomesodermin homolog Regulated Protein
EOMES_HUMAN
[26]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[7]
Mitofusin-2 Regulated Protein
MFN2_HUMAN
[28]
Paired mesoderm homeobox protein 1 Regulated Protein
PRRX1_HUMAN
[29]
Protein Niban Regulated Protein
NIBAN_HUMAN
[30]
Retinoblastoma-associated protein Regulated Protein
RB_HUMAN
[31]
Retinoblastoma-like protein 1 Regulated Protein
RBL1_HUMAN
[7]
Retinoblastoma-like protein 2 Regulated Protein
RBL2_HUMAN
[7]
Rho-related GTP-binding protein RhoC Regulated Protein
RHOC_HUMAN
[32]
Serine/threonine-protein kinase D2 Regulated Protein
KPCD2_HUMAN
[26]
Transcription elongation factor A protein-like 1 Regulated Protein
TCAL1_HUMAN
[33]
Transcription factor E2F5 Regulated Protein
E2F5_HUMAN
[34]
Transcriptional activator protein Pur-alpha Regulated Protein
PURA_HUMAN
[35]
Twist-related protein 1 Regulated Protein
TWST1_HUMAN
[36]
Zinc finger and BTB domain-containing protein 4 Regulated Protein
ZBTB4_HUMAN
[37]
References
REF 1 Downregulation of miR-106b induced breast cancer cell invasion and motility in association with overexpression of matrix metalloproteinase 2. Cancer Sci. 2014 Jan;105(1):18-25.
REF 2 miR-106b inhibits tau phosphorylation at Tyr18 by targeting Fyn in a model of Alzheimer's disease. Biochem Biophys Res Commun. 2016 Sep 16;478(2):852-7.
REF 3 MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol Cell Biol. 2008 Apr;28(7):2167-74.
REF 4 Transcripts targeted by the microRNA-16 family cooperatively regulate cell cycle progression. Mol Cell Biol. 2007 Mar;27(6):2240-52.
REF 5 MicroRNA-106b inhibits osteoclastogenesis and osteolysis by targeting RANKL in giant cell tumor of bone. Oncotarget. 2015 Aug 7;6(22):18980-96.
REF 6 A MDM2-dependent positive-feedback loop is involved in inhibition of miR-375 and miR-106b induced by Helicobacter pylori lipopolysaccharide. Int J Cancer. 2015 May 1;136(9):2120-31.
REF 7 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 8 Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.
REF 9 MiR-106b inhibitors sensitize TRAIL-induced apoptosis in hepatocellular carcinoma through increase of death receptor 4. Oncotarget. 2017 Jun 27;8(26):41921-41931.
REF 10 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 11 Regulation of Insulin Resistance by Multiple MiRNAs via Targeting the GLUT4 Signalling Pathway. Cell Physiol Biochem. 2016;38(5):2063-78.
REF 12 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 13 c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005 Jun 9;435(7043):839-43.
REF 14 MicroRNA-106b-5p boosts glioma tumorigensis by targeting multiple tumor suppressor genes. Oncogene. 2014 Oct 2;33(40):4813-22.
REF 15 MicroRNAs regulate critical genes associated with multiple myeloma pathogenesis. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):12885-90.
REF 16 MicroRNA-regulated pathways associated with endometriosis. Mol Endocrinol. 2009 Feb;23(2):265-75.
REF 17 miR-106b-5p targets tumor suppressor gene SETD2 to inactive its function in clear cell renal cell carcinoma. Oncotarget. 2015 Feb 28;6(6):4066-79.
REF 18 High-throughput screening identifies microRNAs that target Nox2 and improve function after acute myocardial infarction. Am J Physiol Heart Circ Physiol. 2017 May 1;312(5):H1002-H1012.
REF 19 Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33.
REF 20 MicroRNA-106b regulates the tumor suppressor RUNX3 in laryngeal carcinoma cells. FEBS Lett. 2013 Oct 1;587(19):3166-74.
REF 21 miR-106b downregulates adenomatous polyposis coli and promotes cell proliferation in human hepatocellular carcinoma.Carcinogenesis. 2013 Jan;34(1):211-9.
REF 22 MIR106B and MIR93 prevent removal of bacteria from epithelial cells by disrupting ATG16L1-mediated autophagy.Gastroenterology. 2014 Jan;146(1):188-99.
REF 23 TSA suppresses miR-106b-93-25 cluster expression through downregulation of MYC and inhibits proliferation and induces apoptosis in human EMC.PLoS One. 2012;7(9):e45133.
REF 24 MicroRNA-106b is involved in transforming growth factor 1-induced cell migration by targeting disabled homolog 2 in cervical carcinoma.J Exp Clin Cancer Res. 2016 Jan 15;35:11.
REF 25 TRIM8 restores p53 tumour suppressor function by blunting N-MYC activity in chemo-resistant tumours.Mol Cancer. 2017 Mar 21;16(1):67.
REF 26 miR-106b aberrantly expressed in a double transgenic mouse model for Alzheimer's disease targets TGF- type II receptor. Brain Res. 2010 Oct 21;1357:166-74.
REF 27 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 28 MicroRNA-106b induces mitochondrial dysfunction and insulin resistance in C2C12 myotubes by targeting mitofusin-2.Mol Cell Endocrinol. 2013 Dec 5;381(1-2):230-40.
REF 29 Down-regualtion of miR-106b induces epithelial-mesenchymal transition but suppresses metastatic colonization by targeting Prrx1 in colorectal cancer. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10534-44.
REF 30 microRNA-106b-mediated down-regulation of C1orf24 expression induces apoptosis and suppresses invasion of thyroid cancer.Oncotarget. 2015 Sep 29;6(29):28357-70.
REF 31 Differential expression of microRNA species in human gastric cancer versus non-tumorous tissues. J Gastroenterol Hepatol. 2009 Apr;24(4):652-7.
REF 32 Inhibition of Ovarian Epithelial Carcinoma Tumorigenesis and Progression by microRNA 106b Mediated through the RhoC Pathway.PLoS One. 2015 May 1;10(5):e0125714.
REF 33 The microbe-derived short chain fatty acid butyrate targets miRNA-dependent p21 gene expression in human colon cancer.PLoS One. 2011 Jan 20;6(1):e16221.
REF 34 Effects of microRNA-106 on proliferation of gastric cancer cell through regulating p21 and E2F5. Asian Pac J Cancer Prev. 2013;14(5):2839-43.
REF 35 Translation of Pur- is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection.FASEB J. 2012 Nov;26(11):4755-64.
REF 36 MicroRNA-106b modulates epithelial-mesenchymal transition by targeting TWIST1 in invasive endometrial cancer cell lines.Mol Carcinog. 2014 May;53(5):349-59.
REF 37 Induction of the transcriptional repressor ZBTB4 in prostate cancer cells by drug-induced targeting of microRNA-17-92/106b-25 clusters.Mol Cancer Ther. 2012 Sep;11(9):1852-62.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.