Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T19852 | Target Info | |||
Target Name | Keratinocyte growth factor (FGF7) | ||||
Synonyms | KGF; Heparin-binding growth factor 7; HBGF-7; Fibroblast growth factor 7; FGF-7 | ||||
Target Type | Clinical trial Target | ||||
Gene Name | FGF7 | ||||
Biochemical Class | Growth factor | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-155-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uuaaugcuaaucgugauagggguu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | FGF7 is a functional target of miR-155. | [3] | |||
Evidence Score (E-score) | 3 | + | |||
Representative Target(s) Regulated by This miRNA | Acetyl-CoA transporter (SLC33A1) | Target Info | |||
Angiotensin II receptor type-1 (AGTR1) | Target Info | ||||
miRNA Mature ID | hsa-miR-15a-5p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcagcacauaaugguuugug | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | FGF7 is a potential target of miR-15a. | [4] | |||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Target Info | |||
Apoptosis regulator Bcl-2 (BCL-2) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | Identification of keratinocyte growth factor as a target of microRNA-155 in lung fibroblasts: implication in epithelial-mesenchymal interactions. PLoS One. 2009 Aug 24;4(8):e6718. | ||||
REF 2 | Hodgkin lymphoma cell lines are characterized by a specific miRNA expression profile. Neoplasia. 2009 Feb;11(2):167-76. | ||||
REF 3 | Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63. | ||||
REF 4 | Dysregulation of miR-15a and miR-214 in human pancreatic cancer. J Hematol Oncol. 2010 Nov 24;3:46. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.