Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T21960 |
Target Info
|
| Target Name |
Angiopoietin-2 (ANGPT2) |
| Synonyms |
ANG-2 |
| Target Type |
Successful Target |
| Gene Name |
ANGPT2 |
| Biochemical Class |
Fibrinogen protein |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guccaguuuucccaggaaucccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
ANGPT2 is the target gene of miR-145 and sites of interaction of ANGPT2 is in the 3' UTR. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-542-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugugacagauugauaacugaaa
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-542-3p inhibits tumour angiogenesis by targeting Angiopoietin-2. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Angiopoietin-2 (ANGPT2)
|
Target Info
|
|
|
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-145 functions as tumor suppressor and targets two oncogenes, ANGPT2 and NEDD9, in renal cell carcinoma. J Cancer Res Clin Oncol. 2014 Mar;140(3):387-97.
|
| REF 2 |
MiR-145 functions as a tumor suppressor via regulating angiopoietin-2 in pancreatic cancer cells.Cancer Cell Int. 2016 Aug 25;16(1):65.
|
| REF 3 |
MicroRNA-542-3p inhibits tumour angiogenesis by targeting angiopoietin-2. J Pathol. 2014 Apr;232(5):499-508.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
