Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22350 Target Info
Target Name Endoglin CD105 (ENG)
Synonyms Endoglin; END; CD105
Target Type Clinical trial Target
Gene Name ENG
UniProt ID
P17813
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-342-5p miRNA Info
miRNA Mature AC
MIMAT0004694
Sequence aggggugcuaucugugauuga
miRNA Species Homo sapiens
Regulation Mechanism Endoglin mRNA was a direct target of miR-342-5p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
Endoglin CD105 (ENG) Target Info
EGLN_HUMAN
References  Top
REF 1 miR-342-5p Is a Notch Downstream Molecule and Regulates Multiple Angiogenic Pathways Including Notch, Vascular Endothelial Growth Factor and Transforming Growth Factor Signaling. J Am Heart Assoc. 2016 Feb 8;5(2). pii: e003042.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.