Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T23172 |
Target Info
|
| Target Name |
Janus kinase 3 (JAK-3) |
| Synonyms |
Tyrosine-protein kinase JAK3; Leukocyte janus kinase; L-JAK |
| Target Type |
Successful Target |
| Gene Name |
JAK3 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-198 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gguccagaggggagauagguuc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
JAK3 expression level in T cells were counter-regulated by miR-198. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Fibroblast growth factor receptor 1 (FGFR1)
|
Target Info
|
|
|
Janus kinase 3 (JAK-3)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-29b-1-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gcugguuucauauggugguuuaga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
JAK3 expression levels in T cells were counter-regulated by miR-29b. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Janus kinase 3 (JAK-3)
|
Target Info
|
|
|
Mothers against decapentaplegic homolog 3 (SMAD3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-29b and miR-198 overexpression in CD8+ T cells of renal cell carcinoma patients down-modulates JAK3 and MCL-1 leading to immune dysfunction. J Transl Med. 2016 Apr 11;14:84.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
