Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T23276 |
Target Info
|
| Target Name |
Extracellular signal-regulated kinase 1 (ERK1) |
| Synonyms |
PRKM3; P44-MAPK; P44-ERK1; P44 Mitogen-activated protein kinase; Mitogen-activated protein kinase 3; Microtubule-associated protein-2 kinase; Microtubule-associated protein 2 kinase; MAPK 3; MAP kinase isoform p44; MAP kinase 3; Insulin-stimulated MAP2 kinase; ERT2; ERK-1 |
| Target Type |
Clinical trial Target |
| Gene Name |
MAPK3 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-483-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aagacgggaggaaagaagggag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
|
Extracellular signal-regulated kinase 1 (ERK1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Characterization of microRNA profile in human cumulus granulosa cells: Identification of microRNAs that regulate Notch signaling and are associated with PCOS. Mol Cell Endocrinol. 2015 Mar 15;404:26-36.
|
| REF 2 |
MiR-483-5p suppresses the proliferation of glioma cells via directly targeting ERK1. FEBS Lett. 2012 May 7;586(9):1312-7.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
