Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T25726 |
Target Info
|
Target Name |
Glypican-3 (GPC3) |
Synonyms |
Secreted glypican3; OCI5; MXR7; Intestinal protein OCI5; Intestinal protein OCI-5; GTR22; GTR2-2 |
Target Type |
Clinical trial Target |
Gene Name |
GPC3 |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-520c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaagugcuuccuuuuagagggu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
GPC3 was the target of miR- 520c-3p because miR-520c-3p had high affinity to the 3'UTR of the GPC3 gene. |
[1] |
Evidence Score (E-score) |
3 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
3 |
qRT-PCR; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Extracellular matrix receptor III (CD44)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1271-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuuggcaccuagcaagcacuca
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-1271 directly targets GPC3 3'UTR and accelerates its mRNA degradation. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Forkhead box protein Q1 (FOXQ1)
|
Target Info
|
|
Glypican-3 (GPC3)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-520c-3p inhibits hepatocellular carcinoma cell proliferation and invasion through induction of cell apoptosis by targeting glypican-3. Hepatol Res. 2014 Mar;44(3):338-48.
|
REF 2 |
Physalin A induces apoptotic cell death and protective autophagy in HT1080 human fibrosarcoma cells. J Nat Prod. 2013 May 24;76(5):880-8.
|
REF 3 |
Effect of co-transfection of miR-520c-3p and miR-132 on proliferation and apoptosis of hepatocellular carcinoma Huh7. Asian Pac J Trop Med. 2016 Sep;9(9):898-902.
|
REF 4 |
A functional screening identifies five microRNAs controlling glypican-3: role of miR-1271 down-regulation in hepatocellular carcinoma. Hepatology. 2013 Jan;57(1):195-204.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.