Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T27918 Target Info
Target Name ATP-dependent RNA helicase DDX5 (DDX5)
Synonyms RNA helicase p68; Probable ATP-dependent RNA helicase DDX5; HLR1; HELR; G17P1; DEAD box protein 5
Target Type Clinical trial Target
Gene Name DDX5
UniProt ID
P17844
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.