Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T28661 Target Info
Target Name Tubulin beta-2 chain (TUBB2)
Synonyms Tubulin beta-2A chain; Tubulin beta class IIa; TUBB4B; BetaII-Tubulin; Beta(II)-Tubulin; Beta(II) isotype of Tubulin
Target Type Successful Target
Gene Name TUBB2A
UniProt ID
Q13885
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [1]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 miRNA-30a-5p-mediated silencing of Beta2/NeuroD expression is an important initial event of glucotoxicity-induced beta cell dysfunction in rodent models. Diabetologia. 2013 Apr;56(4):847-55.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.