miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-30a-5p
miRNA Stemloop AC MI0000088
miRNA Stemloop ID hsa-mir-30a
Sequence uguaaacauccucgacuggaag
TTD Target(s) Regulated by This miRNA Tyrosine-protein kinase ABL1 (ABL) Successful Target Target Info [1]
Estrogen receptor beta (ESR2) Successful Target Target Info [2]
PI3-kinase delta (PIK3CD) Successful Target Target Info [3]
Tubulin beta-2 chain (TUBB2) Successful Target Target Info [4]
Ecto-5'-nucleotidase (CD73) Clinical trial Target Target Info [5]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [6]
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Clinical trial Target Target Info [7]
Endoplasmic reticulum chaperone BiP (HSPA5) Clinical trial Target Target Info [8]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [9]
Interleukin 21 receptor (IL21R) Clinical trial Target Target Info [10]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [11]
Integrin beta-3 (ITGB3) Literature-reported Target Target Info [12]
Lysyl oxidase (LOX) Literature-reported Target Target Info [13]
Beclin-1 (BECN1) Literature-reported Target Target Info [14]
Epithelial cadherin (CDH1) Literature-reported Target Target Info [15]
Metastasis adhesion protein (MTDH) Literature-reported Target Target Info [5]
Muscleblind-like protein 1 (MBNL2) Literature-reported Target Target Info [16]
S-phase kinase-associated protein 2 (SKP2) Literature-reported Target Target Info [17]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [18]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [19]
Protein(s) Regulated by This miRNA Adapter protein CIKS Regulated Protein
CIKS_HUMAN
[20]
B-cell CLL/lymphoma 9 protein Regulated Protein
BCL9_HUMAN
[21]
B-cell lymphoma/leukemia 11A Regulated Protein
BC11A_HUMAN
[22]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like Regulated Protein
BNI3L_HUMAN
[23]
CD99 antigen Regulated Protein
CD99_HUMAN
[24]
Cell death regulator Aven Regulated Protein
AVEN_HUMAN
[25]
Chromobox protein homolog 3 Regulated Protein
CBX3_HUMAN
[26]
Cyclic AMP-dependent transcription factor ATF-1 Regulated Protein
ATF1_HUMAN
[27]
Denticleless protein homolog Regulated Protein
DTL_HUMAN
[28]
E3 ubiquitin-protein ligase NEDD4-like Regulated Protein
NED4L_HUMAN
[17]
Eyes absent homolog 2 Regulated Protein
EYA2_HUMAN
[30]
Forkhead box protein D1 Regulated Protein
FOXD1_HUMAN
[25]
Forkhead box protein L2 Regulated Protein
FOXL2_HUMAN
[31]
Hepatocyte nuclear factor 4-gamma Regulated Protein
HNF4G_HUMAN
[32]
Krueppel-like factor 9 Regulated Protein
KLF9_HUMAN
[17]
Methylcytosine dioxygenase TET1 Regulated Protein
TET1_HUMAN
[33]
Muscleblind-like protein 1 Regulated Protein
MBNL1_HUMAN
[16]
Muscleblind-like protein 3 Regulated Protein
MBNL3_HUMAN
[16]
Neural cell adhesion molecule 1 Regulated Protein
NCAM1_HUMAN
[35]
Neurogenic differentiation factor 1 Regulated Protein
NDF1_HUMAN
[4]
Perilipin-2 Regulated Protein
PLIN2_HUMAN
[37]
Phosphatidylinositol 3-kinase regulatory subunit beta Regulated Protein
P85B_HUMAN
[38]
PR domain zinc finger protein 1 Regulated Protein
PRDM1_HUMAN
[39]
Proline-rich transmembrane protein 2 Regulated Protein
PRRT2_HUMAN
[40]
Ras-related protein Rab-38 Regulated Protein
RAB38_HUMAN
[17]
Replication protein A 70 kDa DNA-binding subunit Regulated Protein
RFA1_HUMAN
[41]
Septin-7 Regulated Protein
SEPT7_HUMAN
[42]
TGF-beta-activated kinase 1 and MAP3K7-binding protein 3 Regulated Protein
TAB3_HUMAN
[18]
Transcription factor SOX-4 Regulated Protein
SOX4_HUMAN
[44]
Transcriptional regulator ERG Regulated Protein
ERG_HUMAN
[45]
Trinucleotide repeat-containing gene 6A protein Regulated Protein
TNR6A_HUMAN
[46]
Ubiquitin-protein ligase E3C Regulated Protein
UBE3C_HUMAN
[47]
Vimentin Regulated Protein
VIME_HUMAN
[48]
Zinc finger protein SNAI1 Regulated Protein
SNAI1_HUMAN
[49]
References
REF 1 Decreased microRNA-30a levels are associated with enhanced ABL1 and BCR-ABL1 expression in chronic myeloid leukemia. Leuk Res. 2013 Mar;37(3):349-56.
REF 2 Post-transcriptional regulation of human breast cancer cell proteome by unliganded estrogen receptor via microRNAs. Mol Cell Proteomics. 2014 Apr;13(4):1076-90.
REF 3 miR-30a suppresses cell migration and invasion through downregulation of PIK3CD in colorectal carcinoma. Cell Physiol Biochem. 2013;31(2-3):209-18.
REF 4 miRNA-30a-5p-mediated silencing of Beta2/NeuroD expression is an important initial event of glucotoxicity-induced beta cell dysfunction in rodent models. Diabetologia. 2013 Apr;56(4):847-55.
REF 5 Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
REF 6 Downregulation of microRNA-30 facilitates podocyte injury and is prevented by glucocorticoids. J Am Soc Nephrol. 2014 Jan;25(1):92-104.
REF 7 A Feedback Loop Between miR-30a/c-5p and DNMT1 Mediates Cisplatin Resistance in Ovarian Cancer Cells. Cell Physiol Biochem. 2017;41(3):973-986.
REF 8 Downregulation of the miR-30 family microRNAs contributes to endoplasmic reticulum stress in cardiac muscle and vascular smooth muscle cells. Int J Cardiol. 2014 Apr 15;173(1):65-73.
REF 9 A set of differentially expressed miRNAs, including miR-30a-5p, act as post-transcriptional inhibitors of BDNF in prefrontal cortex. Hum Mol Genet. 2008 Oct 1;17(19):3030-42.
REF 10 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 11 Exploration of human miRNA target genes in neuronal differentiation. Nucleic Acids Symp Ser (Oxf). 2005;(49):341-2.
REF 12 MiR-30a-5p Suppresses Tumor Metastasis of Human Colorectal Cancer by Targeting ITGB3. Cell Physiol Biochem. 2016;39(3):1165-76.
REF 13 miR30a inhibits LOX expression and anaplastic thyroid cancer progression. Cancer Res. 2015 Jan 15;75(2):367-77.
REF 14 Regulation of autophagy by a beclin 1-targeted microRNA, miR-30a, in cancer cells. Autophagy. 2009 Aug;5(6):816-23.
REF 15 MicroRNA-30a promotes invasiveness and metastasis initro and inivo through epithelial-mesenchymal transition and results in poor survival of na... Exp Biol Med (Maywood). 2014 Jul;239(7):891-898.
REF 16 miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182.
REF 17 The miR-30 Family Inhibits Pulmonary Vascular Hyperpermeability in the Premetastatic Phase by Direct Targeting of Skp2. Clin Cancer Res. 2015 Jul 1;21(13):3071-80.
REF 18 MiR-30a attenuates immunosuppressive functions of IL-1-elicited mesenchymal stem cells via targeting TAB3. FEBS Lett. 2015 Dec 21;589(24 Pt B):3899-907.
REF 19 Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis. Genome Biol. 2011 Jul 18;12(7):R64.
REF 20 The miR-30a Negatively Regulates IL-17-Mediated Signal Transduction by Targeting Traf3ip2.J Interferon Cytokine Res. 2015 Nov;35(11):917-23.
REF 21 miR-30-5p functions as a tumor suppressor and novel therapeutic tool by targeting the oncogenic Wnt/-catenin/BCL9 pathway.Cancer Res. 2014 Mar 15;74(6):1801-13.
REF 22 BCL11A overexpression predicts survival and relapse in non-small cell lung cancer and is modulated by microRNA-30a and gene amplification.Mol Cancer. 2013 Jun 12;12:61.
REF 23 Alcohol-dysregulated miR-30a and miR-934 in head and neck squamous cell carcinoma. Mol Cancer. 2015 Oct 15;14:181.
REF 24 MiR-30a-5p connects EWS-FLI1 and CD99, two major therapeutic targets in Ewing tumor.Oncogene. 2013 Aug 15;32(33):3915-21.
REF 25 MicroRNA miR-30 family regulates non-attachment growth of breast cancer cells.BMC Genomics. 2013 Feb 28;14:139.
REF 26 Heterochromatin protein HP1 promotes colorectal cancer progression and is regulated by miR-30a.Cancer Res. 2015 Nov 1;75(21):4593-604.
REF 27 miR-30a radiosensitizes non-small cell lung cancer by targeting ATF1 that is involved in the phosphorylation of ATM.Oncol Rep. 2017 Apr;37(4):1980-1988.
REF 28 MiR-30a-5p suppresses tumor growth in colon carcinoma by targeting DTL.Carcinogenesis. 2012 Apr;33(4):732-9.
REF 29 The miR-30 Family Inhibits Pulmonary Vascular Hyperpermeability in the Premetastatic Phase by Direct Targeting of Skp2. Clin Cancer Res. 2015 Jul 1;21(13):3071-80.
REF 30 miR-30a suppresses breast cancer cell proliferation and migration by targeting Eya2.Biochem Biophys Res Commun. 2014 Mar 7;445(2):314-9.
REF 31 MiR-30a upregulates BCL2A1, IER3 and cyclin D2 expression by targeting FOXL2. Oncol Lett. 2015 Feb;9(2):967-971.
REF 32 miR-30-HNF4 and miR-194-NR2F2 regulatory networks contribute to the upregulation of metaplasia markers in the stomach.Gut. 2016 Jun;65(6):914-24.
REF 33 miR-30a as Potential Therapeutics by Targeting TET1 through Regulation of Drp-1 Promoter Hydroxymethylation in Idiopathic Pulmonary Fibrosis.Int J Mol Sci. 2017 Mar 15;18(3). pii: E633.
REF 34 miR-30-5p Regulates Muscle Differentiation and Alternative Splicing of Muscle-Related Genes by Targeting MBNL. Int J Mol Sci. 2016 Jan 29;17(2). pii: E182.
REF 35 MiR-30a-5p is induced by Wnt/-catenin pathway and promotes glioma cell invasion by repressing NCAM.Biochem Biophys Res Commun. 2015 Sep 25;465(3):374-80.
REF 36 miRNA-30a-5p-mediated silencing of Beta2/NeuroD expression is an important initial event of glucotoxicity-induced beta cell dysfunction in rodent models. Diabetologia. 2013 Apr;56(4):847-55.
REF 37 miR-148a and miR-30a limit HCV-dependent suppression of the lipid droplet protein, ADRP, in HCV infected cell models.J Med Virol. 2017 Apr;89(4):653-659.
REF 38 MiR-30a-5p Overexpression May Overcome EGFR-Inhibitor Resistance through Regulating PI3K/AKT Signaling Pathway in Non-small Cell Lung Cancer Cell L... Front Genet. 2016 Nov 15;7:197.
REF 39 PRDM1 is directly targeted by miR-30a-5p and modulates the Wnt/-catenin pathway in a Dkk1-dependent manner during glioma growth.Cancer Lett. 2013 May 1;331(2):211-9.
REF 40 PRRT2 inhibits the proliferation of glioma cells by modulating unfolded protein response pathway.Biochem Biophys Res Commun. 2017 Apr 1;485(2):454-460.
REF 41 miR-30a can inhibit DNA replication by targeting RPA1 thus slowing cancer cell proliferation.Biochem J. 2016 Jul 15;473(14):2131-9.
REF 42 MiR-30a-5p antisense oligonucleotide suppresses glioma cell growth by targeting SEPT7.PLoS One. 2013;8(1):e55008.
REF 43 MiR-30a attenuates immunosuppressive functions of IL-1-elicited mesenchymal stem cells via targeting TAB3. FEBS Lett. 2015 Dec 21;589(24 Pt B):3899-907.
REF 44 Metformin inhibits epithelial-mesenchymal transition in prostate cancer cells: involvement of the tumor suppressor miR30a and its target gene SOX4.Biochem Biophys Res Commun. 2014 Sep 26;452(3):746-52.
REF 45 miR-30 as a tumor suppressor connects EGF/Src signal to ERG and EMT.Oncogene. 2014 May 8;33(19):2495-503.
REF 46 Relative contribution of sequence and structure features to the mRNA binding of Argonaute/EIF2C-miRNA complexes and the degradation of miRNA targets.Genome Res. 2009 Nov;19(11):2009-20.
REF 47 MiR-30a-5p/UBE3C axis regulates breast cancer cell proliferation and migration. Biochem Biophys Res Commun. 2016 Mar 18. pii: S0006-291X(16)30381-3.
REF 48 RUNX3 regulates vimentin expression via miR-30a during epithelial-mesenchymal transition in gastric cancer cells.J Cell Mol Med. 2014 Apr;18(4):610-23.
REF 49 MicroRNA-30a inhibits epithelial-to-mesenchymal transition by targeting Snai1 and is downregulated in non-small cell lung cancer.Int J Cancer. 2012 May 1;130(9):2044-53.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.