Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T28893 |
Target Info
|
| Target Name |
Muscarinic acetylcholine receptor M1 (CHRM1) |
| Synonyms |
M1 receptor |
| Target Type |
Successful Target |
| Gene Name |
CHRM1 |
| Biochemical Class |
GPCR rhodopsin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-107 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agcagcauuguacagggcuauca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
CHRM1 reporter expression is modulated by intracellular miR-107. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Beta-secretase 1 (BACE1)
|
Target Info
|
|
|
Caveolin 1 (CAV1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Decreased cortical muscarinic M1 receptors in schizophrenia are associated with changes in gene promoter methylation, mRNA and gene targeting microRNA. Transl Psychiatry. 2013 Feb 19;3:e230.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
