miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-107
miRNA Stemloop AC MI0000114
miRNA Stemloop ID hsa-mir-107
Sequence agcagcauuguacagggcuauca
TTD Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [1]
Protein kinase C epsilon (PRKCE) Successful Target Target Info [2]
Interleukin-6 (IL6) Successful Target Target Info [3]
Janus kinase 1 (JAK-1) Successful Target Target Info [3]
Muscarinic acetylcholine receptor M1 (CHRM1) Successful Target Target Info [4]
Opioid receptor mu (MOP) Successful Target Target Info [5]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [6]
Beta-secretase 1 (BACE1) Clinical trial Target Target Info [7]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [8]
Notch-2 receptor (NOTCH2) Clinical trial Target Target Info [9]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [10]
Cyclin-dependent kinase 8 (CDK8) Clinical trial Target Target Info [11]
Large tumor suppressor homolog 2 (LATS2) Literature-reported Target Target Info [12]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [10]
G1/S-specific cyclin-E1 (CCNE1) Literature-reported Target Target Info [13]
Maspin (SERPINB5) Literature-reported Target Target Info [14]
DNA repair protein RAD51 homolog 1 (RAD51) Clinical trial Target Target Info [15]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [16]
Caveolin 1 (CAV1) Literature-reported Target Target Info [17]
F-box and WD-40 domain protein 7 (Fbxw7) Literature-reported Target Target Info [18]
Gamma-synuclein (SNCG) Literature-reported Target Target Info [19]
Granulin (GRN) Literature-reported Target Target Info [20]
High mobility group protein HMGI-C (HMGA2) Literature-reported Target Target Info [21]
Protein(s) Regulated by This miRNA Aryl hydrocarbon receptor nuclear translocator Regulated Protein
ARNT_HUMAN
[8]
Axin-2 Regulated Protein
AXIN2_HUMAN
[23]
Cell division control protein 42 homolog Regulated Protein
CDC42_HUMAN
[24]
Cell division cycle-associated protein 4 Regulated Protein
CDCA4_HUMAN
[25]
Chromogranin-A Regulated Protein
CMGA_HUMAN
[26]
Circadian locomoter output cycles protein kaput Regulated Protein
CLOCK_HUMAN
[27]
Crk-like protein Regulated Protein
CRKL_HUMAN
[25]
Cytochrome P450 2C8 Regulated Protein
CP2C8_HUMAN
[28]
Cytoplasmic polyadenylation element-binding protein 1 Regulated Protein
CPEB1_HUMAN
[29]
Death-associated protein kinase 1 Regulated Protein
DAPK1_HUMAN
[10]
E3 ubiquitin-protein ligase SIAH1 Regulated Protein
SIAH1_HUMAN
[31]
Endophilin-A1 Regulated Protein
SH3G2_HUMAN
[32]
Neurofibromin Regulated Protein
NF1_HUMAN
[33]
Nuclear factor 1 A-type Regulated Protein
NFIA_HUMAN
[34]
Protein argonaute-1 Regulated Protein
AGO1_HUMAN
[35]
Protein lin-28 homolog A Regulated Protein
LN28A_HUMAN
[36]
Ras-related protein Rab-1B Regulated Protein
RAB1B_HUMAN
[25]
Sal-like protein 4 Regulated Protein
SALL4_HUMAN
[37]
Zinc finger protein PLAG1 Regulated Protein
PLAG1_HUMAN
[38]
References
REF 1 Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21.
REF 2 microRNA-107 functions as a candidate tumor-suppressor gene in head and neck squamous cell carcinoma by downregulation of protein kinase C. Oncogene. 2012 Sep 6;31(36):4045-53.
REF 3 Hepatitis C virus-induced changes in microRNA 107 (miRNA-107) and miRNA-449a modulate CCL2 by targeting the interleukin-6 receptor complex in hepatitis. J Virol. 2014 Apr;88(7):3733-43.
REF 4 Decreased cortical muscarinic M1 receptors in schizophrenia are associated with changes in gene promoter methylation, mRNA and gene targeting microRNA. Transl Psychiatry. 2013 Feb 19;3:e230.
REF 5 Morphine regulates expression of -opioid receptor MOR-1A, an intron-retention carboxyl terminal splice variant of the -opioid receptor (OPRM1) gene via miR-103/miR-107. Mol Pharmacol. 2014 Feb;85(2):368-80.
REF 6 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 7 The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. J Neurosci. 2008 Jan 30;28(5):1213-23.
REF 8 P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. Proc Natl Acad Sci U S A. 2010 Apr 6;107(14):6334-9.
REF 9 P53-induced microRNA-107 inhibits proliferation of glioma cells and down-regulates the expression of CDK6 and Notch-2. Neurosci Lett. 2013 Feb 8;534:327-32.
REF 10 miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. Cancer Res. 2012 Jul 15;72(14):3631-41.
REF 11 MicroRNA-107 promotes proliferation of gastric cancer cells by targeting cyclin dependent kinase 8. Diagn Pathol. 2014 Aug 28;9:164.
REF 12 miR-107 and miR-25 simultaneously target LATS2 and regulate proliferation and invasion of gastric adenocarcinoma (GAC) cells. Biochem Biophys Res Commun. 2015 May 8;460(3):806-12.
REF 13 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 14 miRNA-7/21/107 contribute to HBx-induced hepatocellular carcinoma progression through suppression of maspin. Oncotarget. 2015 Sep 22;6(28):25962-74.
REF 15 Systematic screen identifies miRNAs that target RAD51 and RAD51D to enhance chemosensitivity. Mol Cancer Res. 2013 Dec;11(12):1564-73.
REF 16 Upregulation of microRNA-107 induces proliferation in human gastric cancer cells by targeting the transcription factor FOXO1. FEBS Lett. 2014 Feb 14;588(4):538-44.
REF 17 miR-103/107 modulates multidrug resistance in human gastric carcinoma by downregulating Cav-1. Tumour Biol. 2015 Apr;36(4):2277-85.
REF 18 Anti-Argonaute RIP-Chip shows that miRNA transfections alter global patterns of mRNA recruitment to microribonucleoprotein complexes. RNA. 2010 Feb;16(2):394-404.
REF 19 Cell-specific post-transcriptional regulation of -synuclein gene by micro-RNAs. PLoS One. 2013 Sep 11;8(9):e73786.
REF 20 miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease. Am J Pathol. 2010 Jul;177(1):334-45.
REF 21 Biochem Biophys Res Commun. 2016 Nov 18;480(3):455-460.
REF 22 P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. Proc Natl Acad Sci U S A. 2010 Apr 6;107(14):6334-9.
REF 23 MicroRNAs modulate the Wnt signaling pathway through targeting its inhibitors.Biochem Biophys Res Commun. 2011 May 6;408(2):259-64.
REF 24 miR-107 functions as a tumor suppressor in human esophageal squamous cell carcinoma and targets Cdc42. Oncol Rep. 2017 May;37(5):3116-3127.
REF 25 MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677.
REF 26 Molecular Mechanism for Hypertensive Renal Disease: Differential Regulation of Chromogranin A Expression at 3'-Untranslated Region Polymorphism C+87T by MicroRNA-107.J Am Soc Nephrol. 2015 Aug;26(8):1816-25.
REF 27 Dietary lipids modulate the expression of miR-107, an miRNA that regulates the circadian system.Mol Nutr Food Res. 2015 Mar;59(3):552-65.
REF 28 Human CYP2C8 is post-transcriptionally regulated by microRNAs 103 and 107 in human liver.Mol Pharmacol. 2012 Sep;82(3):529-40.
REF 29 MicroRNA-107: a novel promoter of tumor progression that targets the CPEB3/EGFR axis in human hepatocellular carcinoma.Oncotarget. 2016 Jan 5;7(1):266-78.
REF 30 miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. Cancer Res. 2012 Jul 15;72(14):3631-41.
REF 31 MiR-107 down-regulates SIAH1 expression in human breast cancer cells and silencing of miR-107 inhibits tumor growth in a nude mouse model of triple-negative breast cancer.Mol Carcinog. 2016 May;55(5):768-77.
REF 32 MicroRNA-107 prevents amyloid-beta induced blood-brain barrier disruption and endothelial cell dysfunction by targeting Endophilin-1.Exp Cell Res. 2016 May 1;343(2):248-257.
REF 33 miR-107 regulates tumor progression by targeting NF1 in gastric cancer.Sci Rep. 2016 Nov 9;6:36531.
REF 34 MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene. 2007 Jun 14;26(28):4148-57.
REF 35 Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67.
REF 36 Overexpression of Lin28 Decreases the Chemosensitivity of Gastric Cancer Cells to Oxaliplatin, Paclitaxel, Doxorubicin, and Fluorouracil in Part via microRNA-107.PLoS One. 2015 Dec 4;10(12):e0143716.
REF 37 Low-expression of microRNA-107 inhibits cell apoptosis in glioma by upregulation of SALL4.Int J Biochem Cell Biol. 2013 Sep;45(9):1962-73.
REF 38 miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia.Blood. 2009 Oct 8;114(15):3255-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.