| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-1-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggaauguaaagaaguauguau
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-1-3p by mature miRNA transfection resulted in the decreased protein level of target HCN4; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target HCN4. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Western Blot; qRT-PCR; Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-133b |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuugguccccuucaaccagcua
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
