miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-133b | ||||
| miRNA Stemloop AC | MI0000822 | ||||
| miRNA Stemloop ID | hsa-mir-133b | ||||
| Sequence | uuugguccccuucaaccagcua | ||||
| TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
| Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [2] | ||
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [3] | ||
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [4] | ||
| C-X-C chemokine receptor type 4 (CXCR4) | Successful Target | Target Info | [5] | ||
| Voltage-gated potassium channel Kv11.1 (KCNH2) | Successful Target | Target Info | [6] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [7] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [8] | ||
| Matrix metalloproteinase-14 (MMP-14) | Clinical trial Target | Target Info | [9] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [10] | ||
| Apoptosis regulator Bcl-W (BCL-W) | Clinical trial Target | Target Info | [11] | ||
| Apoptosis regulator Bcl-xL (BCL-xL) | Clinical trial Target | Target Info | [12] | ||
| Glutathione S-transferase P (GSTP1) | Clinical trial Target | Target Info | [13] | ||
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [11] | ||
| Serine/threonine-protein kinase Sgk1 (SGK1) | Clinical trial Target | Target Info | [14] | ||
| Apoptosis mediating surface antigen FAS (FAS) | Clinical trial Target | Target Info | [15] | ||
| Connective tissue growth factor (CTGF) | Clinical trial Target | Target Info | [16] | ||
| Pyruvate kinase M2 (PKM) | Clinical trial Target | Target Info | [17] | ||
| Fascin (FSCN1) | Clinical trial Target | Target Info | [18] | ||
| Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [19] | ||
| Zinc finger protein GLI1 (Gli1) | Patented-recorded Target | Target Info | [20] | ||
| Transforming protein RhoA (RHOA) | Discontinued Target | Target Info | [21] | ||
| Hyperpolarization cyclic nucleotide-gated channel 2 (HCN2) | Literature-reported Target | Target Info | [22] | ||
| Hyperpolarization cyclic nucleotide-gated channel 4 (HCN4) | Literature-reported Target | Target Info | [22] | ||
| Polypyrimidine tract-binding protein (PTBP1) | Literature-reported Target | Target Info | [23] | ||
| Forkhead box protein C1 (FOXC1) | Literature-reported Target | Target Info | [24] | ||
| Protein(s) Regulated by This miRNA | Cell division control protein 42 homolog | Regulated Protein | [21] | ||
| Copine-3 | Regulated Protein | [26] | |||
| Cyclin-dependent kinase 13 | Regulated Protein | [26] | |||
| Fas apoptotic inhibitory molecule 1 | Regulated Protein | [27] | |||
| Forkhead box protein L2 | Regulated Protein | [28] | |||
| Nuclear pore complex protein Nup214 | Regulated Protein | [29] | |||
| Pituitary homeobox 3 | Regulated Protein | [30] | |||
| Polypyrimidine tract-binding protein 2 | Regulated Protein | [31] | |||
| PR domain zinc finger protein 16 | Regulated Protein | [32] | |||
| RB1-inducible coiled-coil protein 1 | Regulated Protein | [26] | |||
| Receptor-type tyrosine-protein phosphatase kappa | Regulated Protein | [26] | |||
| Serine/threonine-protein kinase 3 | Regulated Protein | [21] | |||
| Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B delta isoform | Regulated Protein | [33] | |||
| Transcriptional activator GLI3 | Regulated Protein | [34] | |||
| Transcriptional regulator ERG | Regulated Protein | [6] | |||
| Transgelin-2 | Regulated Protein | [36] | |||
| References | |||||
| REF 1 | microRNA-133 inhibits cell proliferation, migration and invasion in prostate cancer cells by targeting the epidermal growth factor receptor. Oncol Rep. 2012 Jun;27(6):1967-75. | ||||
| REF 2 | miR-133b acts as a tumor suppressor and negatively regulates FGFR1 in gastric cancer. Tumour Biol. 2013 Apr;34(2):793-803. | ||||
| REF 3 | MicroRNA regulation of neuron-like differentiation of adipose tissue-derived stem cells. Differentiation. 2009 Dec;78(5):253-9. | ||||
| REF 4 | miR-133b regulates the MET proto-oncogene and inhibits the growth of colorectal cancer cells in vitro and in vivo. Cancer Biol Ther. 2010 Jul 15;10(2):190-7. | ||||
| REF 5 | miR-133b, a muscle-specific microRNA, is a novel prognostic marker that participates in the progression of human colorectal cancer via regulation of CXCR4 expression. Mol Cancer. 2013 Dec 13;12:164. | ||||
| REF 6 | MicroRNA miR-133 represses HERG K+ channel expression contributing to QT prolongation in diabetic hearts. J Biol Chem. 2007 Apr 27;282(17):12363-7. | ||||
| REF 7 | microRNA-133b downregulation and inhibition of cell proliferation, migration and invasion by targeting matrix metallopeptidase-9 in renal cell carcinoma. Mol Med Rep. 2014 Jun;9(6):2491-8. | ||||
| REF 8 | MiR-133b regulates bladder cancer cell proliferation and apoptosis by targeting Bcl-w and Akt1. Cancer Cell Int. 2014 Jul 19;14:70. | ||||
| REF 9 | MicroRNA-133b inhibits cell migration and invasion by targeting matrix metalloproteinase 14 in glioblastoma. Oncol Lett. 2015 Nov;10(5):2781-2786. | ||||
| REF 10 | MicroRNA-133b inhibits hepatocellular carcinoma cell progression by targeting Sirt1. Exp Cell Res. 2016 May 1;343(2):135-147. | ||||
| REF 11 | MicroRNA 133B targets pro-survival molecules MCL-1 and BCL2L2 in lung cancer. Biochem Biophys Res Commun. 2009 Oct 23;388(3):483-9. | ||||
| REF 12 | Identification of miRNomes in human stomach and gastric carcinoma reveals miR-133b/a-3p as therapeutic target for gastric cancer. Cancer Lett. 2015 Dec 1;369(1):58-66. | ||||
| REF 13 | MicroRNA-133b targets glutathione S-transferase expression to increase ovarian cancer cell sensitivity to chemotherapy drugs. Drug Des Devel Ther. 2015 Sep 16;9:5225-35. | ||||
| REF 14 | miR-133b Reverses the Hydrosalpinx-induced Impairment of Embryo Attachment Through Down-regulation of SGK1. J Clin Endocrinol Metab. 2016 Apr;101(4):1478-89. | ||||
| REF 15 | MicroRNA-133b-5p Is Involved in Cardioprotection of Morphine Preconditioning in Rat Cardiomyocytes by Targeting Fas. Can J Cardiol. 2016 Aug;32(8):996-1007. | ||||
| REF 16 | TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41. | ||||
| REF 17 | Identification of pyruvate kinase type M2 as potential oncoprotein in squamous cell carcinoma of tongue through microRNA profiling. Int J Cancer. 2008 Jul 15;123(2):251-257. | ||||
| REF 18 | miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14. | ||||
| REF 19 | MiR-145, miR-133a and miR-133b inhibit proliferation, migration, invasion and cell cycle progression via targeting transcription factor Sp1 in gastric cancer. FEBS Lett. 2014 Apr 2;588(7):1168-77. | ||||
| REF 20 | MiR-133b is frequently decreased in gastric cancer and its overexpression reduces the metastatic potential of gastric cancer cells. BMC Cancer. 2014 Jan 21;14:34. | ||||
| REF 21 | MicroRNA-133b is a key promoter of cervical carcinoma development through the activation of the ERK and AKT1 pathways. Oncogene. 2012 Sep 6;31(36):4067-75. | ||||
| REF 22 | Down-regulation of miR-1/miR-133 contributes to re-expression of pacemaker channel genes HCN2 and HCN4 in hypertrophic heart. J Biol Chem. 2008 Jul 18;283(29):20045-52. | ||||
| REF 23 | PTBP1-associated microRNA-1 and -133b suppress the Warburg effect in colorectal tumors. Oncotarget. 2016 Apr 5;7(14):18940-52. | ||||
| REF 24 | miR-133 inhibits pituitary tumor cell migration and invasion via down-regulating FOXC1 expression. Genet Mol Res. 2016 Mar 24;15(1). doi: 10.4238/gmr.15017453. | ||||
| REF 25 | MicroRNA-133b is a key promoter of cervical carcinoma development through the activation of the ERK and AKT1 pathways. Oncogene. 2012 Sep 6;31(36):4067-75. | ||||
| REF 26 | Identification of novel AR-targeted microRNAs mediating androgen signalling through critical pathways to regulate cell viability in prostate cancer. PLoS One. 2013;8(2):e56592. | ||||
| REF 27 | MiR-133b targets antiapoptotic genes and enhances death receptor-induced apoptosis.PLoS One. 2012;7(4):e35345. | ||||
| REF 28 | MicroRNA-133b stimulates ovarian estradiol synthesis by targeting Foxl2.FEBS Lett. 2013 Aug 2;587(15):2474-82. | ||||
| REF 29 | Inhibition of nucleoporin member Nup214 expression by miR-133b perturbs mitotic timing and leads to cell death.Mol Cancer. 2015 Feb 15;14:42. | ||||
| REF 30 | A MicroRNA feedback circuit in midbrain dopamine neurons.Science. 2007 Aug 31;317(5842):1220-4. | ||||
| REF 31 | MicroRNAs regulate the expression of the alternative splicing factor nPTB during muscle development.Genes Dev. 2007 Jan 1;21(1):71-84. | ||||
| REF 32 | MicroRNA-133 controls brown adipose determination in skeletal muscle satellite cells by targeting Prdm16.Cell Metab. 2013 Feb 5;17(2):210-24. | ||||
| REF 33 | Protein phosphatase 2A-B55 enhances chemotherapy sensitivity of human hepatocellular carcinoma under the regulation of microRNA-133b.J Exp Clin Cancer Res. 2016 Apr 14;35:67. | ||||
| REF 34 | MiRNA-133b promotes the proliferation of human Sertoli cells through targeting GLI3.Oncotarget. 2016 Jan 19;7(3):2201-19. | ||||
| REF 35 | MicroRNA miR-133 represses HERG K+ channel expression contributing to QT prolongation in diabetic hearts. J Biol Chem. 2007 Apr 27;282(17):12363-7. | ||||
| REF 36 | MiR-133b regulates the expression of the Actin protein TAGLN2 during oocyte growth and maturation: a potential target for infertility therapy.PLoS One. 2014 Jun 24;9(6):e100751. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.