Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T37693 |
Target Info
|
| Target Name |
Cannabinoid receptor 2 (CB2) |
| Synonyms |
hCB2; Cannabinoid CB2 receptor; CX5; CB2B; CB2A; CB-2 |
| Target Type |
Successful Target |
| Gene Name |
CNR2 |
| Biochemical Class |
GPCR rhodopsin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-665 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
accaggaggcugaggccccu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Cannabinoid receptor 2 (CB2)
|
Target Info
|
|
|
Programmed cell death 1 ligand 1 (PD-L1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-665 is involved in the regulation of the expression of the cardioprotective cannabinoid receptor CB2 in patients with severe heart failure. Biochem Biophys Res Commun. 2014 Sep 5;451(4):516-21.
|
| REF 2 |
Involvement of miR-665 in protection effect of dexmedetomidine against Oxidative Stress Injury in myocardial cells via CB2 and CK1. Biomed Pharmacother. 2019 Jul;115:108894.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
