Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38996 Target Info
Target Name Phospholipase D1 (PLD1)
Synonyms Phosphatidylcholine-hydrolyzing phospholipase D1; PLD 1; HPLD1; Choline phosphatase 1
Target Type Patented-recorded Target
Gene Name PLD1
Biochemical Class Phosphoric diester hydrolase
UniProt ID
Q13393
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Regulation Mechanism Expression of PLD1 protein in MDA-MB- 231 cells is decreased after transfection with miR-182 mimics. [2]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-638 miRNA Info
miRNA Mature AC
MIMAT0003308
Sequence agggaucgcgggcggguggcggccu
miRNA Species Homo sapiens
Regulation Mechanism PLD1 was down-regulated by miR-638. [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
References  Top
REF 1 Down-regulation of MicroRNAs (MiRs) 203, 887, 3619 and 182 Prevents Vimentin-triggered, Phospholipase D (PLD)-mediated Cancer Cell Invasion. J Biol Chem. 2016 Jan 8;291(2):719-30.
REF 2 A Repertoire of MicroRNAs Regulates Cancer Cell Starvation by Targeting Phospholipase D in a Feedback Loop That Operates Maximally in Cancer Cells. Mol Cell Biol. 2016 Jan 19;36(7):1078-89.
REF 3 MicroRNA-638 inhibits cell proliferation by targeting phospholipase D1 in human gastric carcinoma. Protein Cell. 2015 Sep;6(9):680-688.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.