Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T38996 | Target Info | |||
| Target Name | Phospholipase D1 (PLD1) | ||||
| Synonyms | Phosphatidylcholine-hydrolyzing phospholipase D1; PLD 1; HPLD1; Choline phosphatase 1 | ||||
| Target Type | Patented-recorded Target | ||||
| Gene Name | PLD1 | ||||
| Biochemical Class | Phosphoric diester hydrolase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-182-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uuuggcaaugguagaacucacacu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Expression of PLD1 protein in MDA-MB- 231 cells is decreased after transfection with miR-182 mimics. | [2] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [1] | |||
| 2 | Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Brain-derived neurotrophic factor (BDNF) | Target Info | ||||
| miRNA Mature ID | hsa-miR-638 | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | agggaucgcgggcggguggcggccu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | PLD1 was down-regulated by miR-638. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Immunohistochemistry; Luciferase Reporter Assay | [3] | |||
| Representative Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Target Info | |||
| Cyclin-dependent kinase 2 (CDK2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Down-regulation of MicroRNAs (MiRs) 203, 887, 3619 and 182 Prevents Vimentin-triggered, Phospholipase D (PLD)-mediated Cancer Cell Invasion. J Biol Chem. 2016 Jan 8;291(2):719-30. | ||||
| REF 2 | A Repertoire of MicroRNAs Regulates Cancer Cell Starvation by Targeting Phospholipase D in a Feedback Loop That Operates Maximally in Cancer Cells. Mol Cell Biol. 2016 Jan 19;36(7):1078-89. | ||||
| REF 3 | MicroRNA-638 inhibits cell proliferation by targeting phospholipase D1 in human gastric carcinoma. Protein Cell. 2015 Sep;6(9):680-688. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.