Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T39977 Target Info
Target Name Macrophage migration inhibitory factor (MIF)
Synonyms Phenylpyruvate tautomerase; MMIF; L-dopachrome tautomerase; L-dopachrome isomerase; Glycosylation-inhibiting factor; GLIF; GIF
Target Type Clinical trial Target
Gene Name MIF
Biochemical Class Intramolecular oxidoreductase
UniProt ID
P14174
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-451a by mature miRNA precursor transfection resulted in the decreased protein level of target MIF. [3]
Evidence Score (E-score) 4 +
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-146a mimics resulted in the decreased bith protein and mRNA of MIF. [5]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-1228-5p miRNA Info
miRNA Mature AC
MIMAT0005582
Sequence gugggcgggggcaggugugug
miRNA Species Homo sapiens
Regulation Mechanism miR-1228 acts as a negative regulator of gastric cancer growth and angiogenesis through downregulation of MIF. [6]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Macrophage migration inhibitory factor (MIF) Target Info
MIF_HUMAN
References  Top
REF 1 MiR-451 suppresses proliferation, migration and promotes apoptosis of the human osteosarcoma by targeting macrophage migration inhibitory factor. Biomed Pharmacother. 2017 Mar;87:621-627.
REF 2 microRNA-451 inhibited cell proliferation, migration and invasion through regulation of MIF in renal cell carcinoma. Int J Clin Exp Pathol. 2015 Dec 1;8(12):15611-21.
REF 3 microRNA-451 regulates macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells. Clin Cancer Res. 2009 Apr 1;15(7):2281-90.
REF 4 MiR-451 inhibits cell growth and invasion by targeting MIF and is associated with survival in nasopharyngeal carcinoma. Mol Cancer. 2013 Oct 20;12(1):123.
REF 5 Effect and molecular mechanism of mir-146a on proliferation of lung cancer cells by targeting and regulating MIF gene. Asian Pac J Trop Med. 2016 Aug;9(8):806-11.
REF 6 microRNA-1228 /sup> impairs the pro-angiogenic activity of gastric cancer cells by targeting macrophage migration inhibitory factor. Life Sci. 2017 Jul 1;180:9-16.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.