Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T44011 Target Info
Target Name Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1)
Synonyms Short chain dehydrogenase/reductase family 28C member 1; SDR28C1; Placental 17-beta-hydroxysteroid dehydrogenase; Estradiol 17-beta-dehydrogenase 1; EDHB17; EDH17B2; EDH17B1; E2DH; E17KSR; 20-alpha-HSD; 20 alpha-hydroxysteroid dehydrogenase; 17-beta-Hydroxysteroid dehydrogenase type 1; 17-beta-HSD 1
Target Type Clinical trial Target
Gene Name HSD17B1
Biochemical Class CH-OH donor oxidoreductase
UniProt ID
P14061
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism HSD17B1 Is a Target of miR-210 in Human Trophoblastic Cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-518c-3p miRNA Info
miRNA Mature AC
MIMAT0002848
Sequence caaagcgcuucucuuuagagugu
miRNA Species Homo sapiens
Regulation Mechanism HSD17B1 Is a Target of miR-518c in Human Trophoblastic Cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1) Target Info
DHB1_HUMAN
References  Top
REF 1 Hydroxysteroid (17-) dehydrogenase 1 is dysregulated by miR-210 and miR-518c that are aberrantly expressed in preeclamptic placentas: a novel marker for predicting preeclampsia. Hypertension. 2012 Feb;59(2):265-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.