Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T44011 | Target Info | |||
Target Name | Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1) | ||||
Synonyms | Short chain dehydrogenase/reductase family 28C member 1; SDR28C1; Placental 17-beta-hydroxysteroid dehydrogenase; Estradiol 17-beta-dehydrogenase 1; EDHB17; EDH17B2; EDH17B1; E2DH; E17KSR; 20-alpha-HSD; 20 alpha-hydroxysteroid dehydrogenase; 17-beta-Hydroxysteroid dehydrogenase type 1; 17-beta-HSD 1 | ||||
Target Type | Clinical trial Target | ||||
Gene Name | HSD17B1 | ||||
Biochemical Class | CH-OH donor oxidoreductase | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-210-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | cugugcgugugacagcggcuga | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | HSD17B1 Is a Target of miR-210 in Human Trophoblastic Cells. | [1] | |||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Activin receptor type IB (ACVR1B) | Target Info | |||
Autophagy-related protein 7 (ATG7) | Target Info | ||||
miRNA Mature ID | hsa-miR-518c-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | caaagcgcuucucuuuagagugu | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | HSD17B1 Is a Target of miR-518c in Human Trophoblastic Cells. | [1] | |||
Evidence Score (E-score) | 1 | + | |||
Representative Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Target Info | |||
Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | Hydroxysteroid (17-) dehydrogenase 1 is dysregulated by miR-210 and miR-518c that are aberrantly expressed in preeclamptic placentas: a novel marker for predicting preeclampsia. Hypertension. 2012 Feb;59(2):265-73. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.