The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-181c-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aacauucaaccugucggugagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-181c regulated the expression of PRKCD by combining with its 3' UTR. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Dual Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Bone morphogenetic protein receptor (BMPR2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-26a-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccuauucuugguuacuugcacg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-26a directly targets PRKCD crucial for insulin signaling and metabolism of lipid and glucose. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Caspase-3 (CASP3)
|
Target Info
|
|